\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610865809:

Variant ID: vg0610865809 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10865809
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGAATATATGCAAGGCGTACAAAGAATATAGTTCATCAAGGAGGTTTCATAACAAGCCTATTATAAATAGTTTTTCCCTACTTTGTAAAACATTTCATT[T/C]
GCAAACAGTTGTAAACCATCATTTAGTAGCAATATTAATCACCATTCATCCTCATCTTCATCATATTCCATATTTTAATTTAAAATCTACTCATACCATG

Reverse complement sequence

CATGGTATGAGTAGATTTTAAATTAAAATATGGAATATGATGAAGATGAGGATGAATGGTGATTAATATTGCTACTAAATGATGGTTTACAACTGTTTGC[A/G]
AATGAAATGTTTTACAAAGTAGGGAAAAACTATTTATAATAGGCTTGTTATGAAACCTCCTTGATGAACTATATTCTTTGTACGCCTTGCATATATTCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.60% 0.20% 7.85% 43.33% NA
All Indica  2759 20.00% 0.30% 13.34% 66.33% NA
All Japonica  1512 92.30% 0.00% 0.07% 7.61% NA
Aus  269 84.00% 0.00% 0.00% 15.99% NA
Indica I  595 11.10% 0.20% 8.24% 80.50% NA
Indica II  465 5.80% 1.10% 20.00% 73.12% NA
Indica III  913 28.50% 0.00% 13.36% 58.16% NA
Indica Intermediate  786 25.30% 0.40% 13.23% 61.07% NA
Temperate Japonica  767 96.60% 0.00% 0.00% 3.39% NA
Tropical Japonica  504 85.10% 0.00% 0.20% 14.68% NA
Japonica Intermediate  241 93.80% 0.00% 0.00% 6.22% NA
VI/Aromatic  96 80.20% 0.00% 1.04% 18.75% NA
Intermediate  90 52.20% 0.00% 1.11% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610865809 T -> C LOC_Os06g19090.1 downstream_gene_variant ; 3226.0bp to feature; MODIFIER silent_mutation Average:6.173; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0610865809 T -> C LOC_Os06g19100.1 downstream_gene_variant ; 3164.0bp to feature; MODIFIER silent_mutation Average:6.173; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0610865809 T -> C LOC_Os06g19095.1 intron_variant ; MODIFIER silent_mutation Average:6.173; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0610865809 T -> DEL N N silent_mutation Average:6.173; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610865809 NA 2.08E-07 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 2.14E-10 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 8.69E-10 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 1.46E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 4.20E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 4.93E-07 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 7.07E-10 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 1.85E-08 4.92E-24 mr1255 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 1.29E-07 2.74E-11 mr1255 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 7.73E-06 NA mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 6.05E-06 1.08E-11 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 2.75E-08 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 1.52E-10 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 1.21E-07 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 4.16E-10 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 3.79E-11 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 2.75E-09 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 2.46E-09 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 7.37E-08 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 2.02E-21 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 8.22E-10 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 1.96E-09 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 8.16E-08 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 5.81E-07 mr1597_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 2.70E-06 mr1597_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809 NA 4.30E-06 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251