Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610865809:

Variant ID: vg0610865809 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10865809
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGAATATATGCAAGGCGTACAAAGAATATAGTTCATCAAGGAGGTTTCATAACAAGCCTATTATAAATAGTTTTTCCCTACTTTGTAAAACATTTCATT[T/C]
GCAAACAGTTGTAAACCATCATTTAGTAGCAATATTAATCACCATTCATCCTCATCTTCATCATATTCCATATTTTAATTTAAAATCTACTCATACCATG

Reverse complement sequence

CATGGTATGAGTAGATTTTAAATTAAAATATGGAATATGATGAAGATGAGGATGAATGGTGATTAATATTGCTACTAAATGATGGTTTACAACTGTTTGC[A/G]
AATGAAATGTTTTACAAAGTAGGGAAAAACTATTTATAATAGGCTTGTTATGAAACCTCCTTGATGAACTATATTCTTTGTACGCCTTGCATATATTCTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.60%	0.20%	7.85%	43.33%	NA
All Indica	2759	20.00%	0.30%	13.34%	66.33%	NA
All Japonica	1512	92.30%	0.00%	0.07%	7.61%	NA
Aus	269	84.00%	0.00%	0.00%	15.99%	NA
Indica I	595	11.10%	0.20%	8.24%	80.50%	NA
Indica II	465	5.80%	1.10%	20.00%	73.12%	NA
Indica III	913	28.50%	0.00%	13.36%	58.16%	NA
Indica Intermediate	786	25.30%	0.40%	13.23%	61.07%	NA
Temperate Japonica	767	96.60%	0.00%	0.00%	3.39%	NA
Tropical Japonica	504	85.10%	0.00%	0.20%	14.68%	NA
Japonica Intermediate	241	93.80%	0.00%	0.00%	6.22%	NA
VI/Aromatic	96	80.20%	0.00%	1.04%	18.75%	NA
Intermediate	90	52.20%	0.00%	1.11%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610865809	T -> C	LOC_Os06g19090.1	downstream_gene_variant ; 3226.0bp to feature; MODIFIER	silent_mutation	Average:6.173; most accessible tissue: Zhenshan97 flower, score: 11.396	N	N	N	N
vg0610865809	T -> C	LOC_Os06g19100.1	downstream_gene_variant ; 3164.0bp to feature; MODIFIER	silent_mutation	Average:6.173; most accessible tissue: Zhenshan97 flower, score: 11.396	N	N	N	N
vg0610865809	T -> C	LOC_Os06g19095.1	intron_variant ; MODIFIER	silent_mutation	Average:6.173; most accessible tissue: Zhenshan97 flower, score: 11.396	N	N	N	N
vg0610865809	T -> DEL	N	N	silent_mutation	Average:6.173; most accessible tissue: Zhenshan97 flower, score: 11.396	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610865809	NA	2.08E-07	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	2.14E-10	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	8.69E-10	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	1.46E-06	mr1235	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	4.20E-06	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	4.93E-07	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	7.07E-10	mr1251	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	1.85E-08	4.92E-24	mr1255	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	1.29E-07	2.74E-11	mr1255	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	7.73E-06	NA	mr1257	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	6.05E-06	1.08E-11	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	2.75E-08	mr1423	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	1.52E-10	mr1435	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	1.21E-07	mr1599	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	4.16E-10	mr1109_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	3.79E-11	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	2.75E-09	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	2.46E-09	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	7.37E-08	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	2.02E-21	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	8.22E-10	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	1.96E-09	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	8.16E-08	mr1435_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	5.81E-07	mr1597_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	2.70E-06	mr1597_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865809	NA	4.30E-06	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251