\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610865756:

Variant ID: vg0610865756 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10865756
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAGAGGTGAGTACCGAGGTACCCAGCAAGCCACACATCCATAAAAATACAAATAGAATATATGCAAGGCGTACAAAGAATATAGTTCATCAAGGAGGTT[T/C]
CATAACAAGCCTATTATAAATAGTTTTTCCCTACTTTGTAAAACATTTCATTTGCAAACAGTTGTAAACCATCATTTAGTAGCAATATTAATCACCATTC

Reverse complement sequence

GAATGGTGATTAATATTGCTACTAAATGATGGTTTACAACTGTTTGCAAATGAAATGTTTTACAAAGTAGGGAAAAACTATTTATAATAGGCTTGTTATG[A/G]
AACCTCCTTGATGAACTATATTCTTTGTACGCCTTGCATATATTCTATTTGTATTTTTATGGATGTGTGGCTTGCTGGGTACCTCGGTACTCACCTCTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.80% 0.70% 9.39% 41.03% NA
All Indica  2759 20.20% 1.20% 15.73% 62.85% NA
All Japonica  1512 92.70% 0.00% 0.13% 7.14% NA
Aus  269 84.00% 0.00% 1.49% 14.50% NA
Indica I  595 10.90% 1.30% 13.45% 74.29% NA
Indica II  465 6.90% 3.20% 24.73% 65.16% NA
Indica III  913 28.90% 0.00% 12.81% 58.27% NA
Indica Intermediate  786 24.90% 1.40% 15.52% 58.14% NA
Temperate Japonica  767 96.60% 0.00% 0.13% 3.26% NA
Tropical Japonica  504 86.50% 0.00% 0.20% 13.29% NA
Japonica Intermediate  241 93.40% 0.00% 0.00% 6.64% NA
VI/Aromatic  96 81.20% 0.00% 1.04% 17.71% NA
Intermediate  90 50.00% 1.10% 3.33% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610865756 T -> C LOC_Os06g19090.1 downstream_gene_variant ; 3173.0bp to feature; MODIFIER silent_mutation Average:5.133; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0610865756 T -> C LOC_Os06g19100.1 downstream_gene_variant ; 3217.0bp to feature; MODIFIER silent_mutation Average:5.133; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0610865756 T -> C LOC_Os06g19095.1 intron_variant ; MODIFIER silent_mutation Average:5.133; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0610865756 T -> DEL N N silent_mutation Average:5.133; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610865756 NA 5.54E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 7.27E-09 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 7.29E-08 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 5.57E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 9.50E-07 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 9.02E-08 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 3.48E-07 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 3.09E-19 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 9.13E-09 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 3.56E-09 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 2.88E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 8.29E-08 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 9.32E-08 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 2.26E-10 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 1.33E-06 mr1198_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 1.65E-09 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 3.49E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 7.51E-10 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 3.14E-06 mr1229_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 4.92E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 8.60E-06 2.87E-11 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 3.23E-06 9.36E-12 mr1236_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 4.31E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 8.23E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 5.47E-06 mr1516_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 6.53E-06 6.53E-06 mr1596_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 3.00E-07 1.50E-09 mr1597_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 2.36E-07 2.72E-09 mr1597_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 1.30E-06 mr1763_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 3.37E-06 mr1784_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 4.78E-06 mr1785_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 6.87E-06 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 4.31E-06 2.50E-08 mr1863_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 8.56E-06 4.41E-07 mr1863_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 8.41E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 NA 2.62E-08 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610865756 6.67E-07 2.51E-08 mr1880_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251