Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610860716:

Variant ID: vg0610860716 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10860716
Reference Allele: T	Alternative Allele: C,G
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

ATCCCAACACCAGAGGGGATTGAATTTCTCGGGGATGCGGTTAACCAGTTCATACTCTGGCATCATCGAGACAACATCCTCACTGGACAGTTCACGTTGA[T/C,G]
GACCCCAGCTCCATCGGTGCCAAATATGGCTGCACCTCCTGCACCGTCGTCCCCTCCGATCTGCACTACCCCACCCGGATCTCCACTACCACAAATATCA

Reverse complement sequence

TGATATTTGTGGTAGTGGAGATCCGGGTGGGGTAGTGCAGATCGGAGGGGACGACGGTGCAGGAGGTGCAGCCATATTTGGCACCGATGGAGCTGGGGTC[A/G,C]
TCAACGTGAACTGTCCAGTGAGGATGTTGTCTCGATGATGCCAGAGTATGAACTGGTTAACCGCATCCCCGAGAAATTCAATCCCCTCTGGTGTTGGGAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.20%	34.50%	12.27%	0.04%	G: 0.04%
All Indica	2759	26.60%	55.10%	18.27%	0.07%	G: 0.04%
All Japonica	1512	94.30%	1.90%	3.77%	0.00%	G: 0.07%
Aus	269	84.00%	15.20%	0.74%	0.00%	NA
Indica I	595	16.80%	56.50%	26.55%	0.17%	NA
Indica II	465	13.10%	62.60%	24.09%	0.22%	NA
Indica III	913	35.60%	52.10%	12.16%	0.00%	G: 0.11%
Indica Intermediate	786	31.40%	52.90%	15.65%	0.00%	NA
Temperate Japonica	767	96.90%	1.00%	1.96%	0.00%	G: 0.13%
Tropical Japonica	504	91.10%	1.80%	7.14%	0.00%	NA
Japonica Intermediate	241	92.90%	4.60%	2.49%	0.00%	NA
VI/Aromatic	96	80.20%	14.60%	5.21%	0.00%	NA
Intermediate	90	55.60%	31.10%	13.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610860716	T -> C	LOC_Os06g19095.1	downstream_gene_variant ; 4679.0bp to feature; MODIFIER	silent_mutation	Average:29.526; most accessible tissue: Callus, score: 58.885	N	N	N	N
vg0610860716	T -> C	LOC_Os06g19090.1	intron_variant ; MODIFIER	silent_mutation	Average:29.526; most accessible tissue: Callus, score: 58.885	N	N	N	N
vg0610860716	T -> G	LOC_Os06g19095.1	downstream_gene_variant ; 4679.0bp to feature; MODIFIER	silent_mutation	Average:29.526; most accessible tissue: Callus, score: 58.885	N	N	N	N
vg0610860716	T -> G	LOC_Os06g19090.1	intron_variant ; MODIFIER	silent_mutation	Average:29.526; most accessible tissue: Callus, score: 58.885	N	N	N	N
vg0610860716	T -> DEL	N	N	silent_mutation	Average:29.526; most accessible tissue: Callus, score: 58.885	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610860716	8.35E-06	NA	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610860716	NA	2.81E-06	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610860716	NA	8.06E-07	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610860716	NA	3.13E-06	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610860716	NA	2.96E-20	mr1218_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610860716	1.03E-06	7.75E-25	mr1877_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251