\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610852582:

Variant ID: vg0610852582 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10852582
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGGCCTTAACATACAGATCCCGGTGCTACGATGCCAATGGGTCAGAGACACAACAGGCGTATCCATCGATGACTACGGCCTGATGGTTGTGGATCGTAG[C/A]
AAACTAGGACACAAGGATGATCCGTGGGTTCTTGCTAAGCGTGTTGCTCAGGTTTTCTATGTCAATGATCCTTTCGACGATAAGATGGCCATTGCTGTAC

Reverse complement sequence

GTACAGCAATGGCCATCTTATCGTCGAAAGGATCATTGACATAGAAAACCTGAGCAACACGCTTAGCAAGAACCCACGGATCATCCTTGTGTCCTAGTTT[G/T]
CTACGATCCACAACCATCAGGCCGTAGTCATCGATGGATACGCCTGTTGTGTCTCTGACCCATTGGCATCGTAGCACCGGGATCTGTATGTTAAGGCCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.50% 22.80% 1.99% 3.68% NA
All Indica  2759 94.00% 3.20% 0.76% 2.07% NA
All Japonica  1512 42.80% 45.10% 4.56% 7.54% NA
Aus  269 19.30% 79.90% 0.74% 0.00% NA
Indica I  595 86.90% 2.20% 2.86% 8.07% NA
Indica II  465 96.30% 3.20% 0.22% 0.22% NA
Indica III  913 98.50% 1.40% 0.11% 0.00% NA
Indica Intermediate  786 92.70% 6.00% 0.25% 1.02% NA
Temperate Japonica  767 62.60% 34.90% 0.52% 1.96% NA
Tropical Japonica  504 19.00% 55.60% 10.12% 15.28% NA
Japonica Intermediate  241 29.50% 55.60% 5.81% 9.13% NA
VI/Aromatic  96 29.20% 68.80% 2.08% 0.00% NA
Intermediate  90 66.70% 30.00% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610852582 C -> A LOC_Os06g19080.1 missense_variant ; p.Ser878Arg; MODERATE nonsynonymous_codon ; S878R Average:16.082; most accessible tissue: Minghui63 young leaf, score: 24.836 possibly damaging 1.611 DELETERIOUS 0.03
vg0610852582 C -> DEL LOC_Os06g19080.1 N frameshift_variant Average:16.082; most accessible tissue: Minghui63 young leaf, score: 24.836 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610852582 1.29E-07 1.29E-07 mr1192_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 4.84E-06 4.84E-06 mr1311_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 7.13E-08 7.13E-08 mr1312_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 2.71E-06 2.71E-06 mr1329_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 8.58E-06 8.58E-06 mr1373_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 3.49E-06 3.49E-06 mr1374_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 1.09E-06 1.09E-06 mr1524_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 4.58E-06 4.58E-06 mr1634_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 5.96E-06 5.96E-06 mr1645_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 4.42E-06 4.42E-06 mr1647_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 6.18E-07 6.18E-07 mr1663_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 2.81E-06 2.81E-06 mr1669_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 4.39E-06 4.39E-06 mr1674_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 8.52E-06 2.64E-06 mr1683_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 5.14E-07 5.14E-07 mr1688_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 8.52E-06 8.52E-06 mr1760_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 3.93E-07 3.93E-07 mr1766_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 9.80E-06 2.92E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 5.81E-06 5.81E-06 mr1822_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 1.44E-06 1.44E-06 mr1832_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 2.85E-06 5.95E-07 mr1833_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 2.82E-07 2.82E-07 mr1843_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 4.74E-07 4.74E-07 mr1847_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582 1.77E-06 1.77E-06 mr1970_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251