Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610852582:

Variant ID: vg0610852582 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10852582
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGGCCTTAACATACAGATCCCGGTGCTACGATGCCAATGGGTCAGAGACACAACAGGCGTATCCATCGATGACTACGGCCTGATGGTTGTGGATCGTAG[C/A]
AAACTAGGACACAAGGATGATCCGTGGGTTCTTGCTAAGCGTGTTGCTCAGGTTTTCTATGTCAATGATCCTTTCGACGATAAGATGGCCATTGCTGTAC

Reverse complement sequence

GTACAGCAATGGCCATCTTATCGTCGAAAGGATCATTGACATAGAAAACCTGAGCAACACGCTTAGCAAGAACCCACGGATCATCCTTGTGTCCTAGTTT[G/T]
CTACGATCCACAACCATCAGGCCGTAGTCATCGATGGATACGCCTGTTGTGTCTCTGACCCATTGGCATCGTAGCACCGGGATCTGTATGTTAAGGCCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.50%	22.80%	1.99%	3.68%	NA
All Indica	2759	94.00%	3.20%	0.76%	2.07%	NA
All Japonica	1512	42.80%	45.10%	4.56%	7.54%	NA
Aus	269	19.30%	79.90%	0.74%	0.00%	NA
Indica I	595	86.90%	2.20%	2.86%	8.07%	NA
Indica II	465	96.30%	3.20%	0.22%	0.22%	NA
Indica III	913	98.50%	1.40%	0.11%	0.00%	NA
Indica Intermediate	786	92.70%	6.00%	0.25%	1.02%	NA
Temperate Japonica	767	62.60%	34.90%	0.52%	1.96%	NA
Tropical Japonica	504	19.00%	55.60%	10.12%	15.28%	NA
Japonica Intermediate	241	29.50%	55.60%	5.81%	9.13%	NA
VI/Aromatic	96	29.20%	68.80%	2.08%	0.00%	NA
Intermediate	90	66.70%	30.00%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610852582	C -> A	LOC_Os06g19080.1	missense_variant ; p.Ser878Arg; MODERATE	nonsynonymous_codon ; S878R	Average:16.082; most accessible tissue: Minghui63 young leaf, score: 24.836	possibly damaging	1.611	DELETERIOUS	0.03
vg0610852582	C -> DEL	LOC_Os06g19080.1	N	frameshift_variant	Average:16.082; most accessible tissue: Minghui63 young leaf, score: 24.836	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610852582	1.29E-07	1.29E-07	mr1192_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	4.84E-06	4.84E-06	mr1311_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	7.13E-08	7.13E-08	mr1312_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	2.71E-06	2.71E-06	mr1329_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	8.58E-06	8.58E-06	mr1373_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	3.49E-06	3.49E-06	mr1374_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	1.09E-06	1.09E-06	mr1524_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	4.58E-06	4.58E-06	mr1634_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	5.96E-06	5.96E-06	mr1645_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	4.42E-06	4.42E-06	mr1647_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	6.18E-07	6.18E-07	mr1663_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	2.81E-06	2.81E-06	mr1669_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	4.39E-06	4.39E-06	mr1674_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	8.52E-06	2.64E-06	mr1683_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	5.14E-07	5.14E-07	mr1688_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	8.52E-06	8.52E-06	mr1760_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	3.93E-07	3.93E-07	mr1766_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	9.80E-06	2.92E-06	mr1812_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	5.81E-06	5.81E-06	mr1822_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	1.44E-06	1.44E-06	mr1832_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	2.85E-06	5.95E-07	mr1833_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	2.82E-07	2.82E-07	mr1843_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	4.74E-07	4.74E-07	mr1847_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610852582	1.77E-06	1.77E-06	mr1970_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251