\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610849223:

Variant ID: vg0610849223 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10849223
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.19, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCCATTTTTGTCAGTTTTCATCGGTGGAATACGAAGAAACTTGCGCTTTTATAAATGGAATAGTGTAGGCACTTTTTTGTTTTTTTATTTTTTTTAGC[G/A]
AGTACATAATAATTCCATTACATGTTTATAAAAGTATTTAGTACCTAAATTGAAAAGTTGGGTTTGTCTCTATTGAATTTATTTTCATTTGGATGAAAGA

Reverse complement sequence

TCTTTCATCCAAATGAAAATAAATTCAATAGAGACAAACCCAACTTTTCAATTTAGGTACTAAATACTTTTATAAACATGTAATGGAATTATTATGTACT[C/T]
GCTAAAAAAAATAAAAAAACAAAAAAGTGCCTACACTATTCCATTTATAAAAGCGCAAGTTTCTTCGTATTCCACCGATGAAAACTGACAAAAATGGAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.40% 20.50% 5.65% 46.36% NA
All Indica  2759 4.00% 15.30% 8.37% 72.38% NA
All Japonica  1512 57.70% 34.30% 0.99% 7.01% NA
Aus  269 81.00% 2.60% 2.97% 13.38% NA
Indica I  595 3.20% 7.70% 10.59% 78.49% NA
Indica II  465 3.90% 2.80% 7.10% 86.24% NA
Indica III  913 2.00% 25.20% 9.09% 63.75% NA
Indica Intermediate  786 6.90% 16.90% 6.62% 69.59% NA
Temperate Japonica  767 37.30% 59.10% 0.39% 3.26% NA
Tropical Japonica  504 82.50% 3.20% 1.19% 13.10% NA
Japonica Intermediate  241 70.50% 20.70% 2.49% 6.22% NA
VI/Aromatic  96 71.90% 8.30% 3.12% 16.67% NA
Intermediate  90 32.20% 16.70% 11.11% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610849223 G -> A LOC_Os06g19070.1 upstream_gene_variant ; 3203.0bp to feature; MODIFIER silent_mutation Average:11.698; most accessible tissue: Callus, score: 45.108 N N N N
vg0610849223 G -> A LOC_Os06g19080.1 upstream_gene_variant ; 600.0bp to feature; MODIFIER silent_mutation Average:11.698; most accessible tissue: Callus, score: 45.108 N N N N
vg0610849223 G -> A LOC_Os06g19070-LOC_Os06g19080 intergenic_region ; MODIFIER silent_mutation Average:11.698; most accessible tissue: Callus, score: 45.108 N N N N
vg0610849223 G -> DEL N N silent_mutation Average:11.698; most accessible tissue: Callus, score: 45.108 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610849223 6.04E-10 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849223 NA 4.09E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849223 1.93E-06 NA mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849223 8.10E-06 NA mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849223 1.43E-06 NA mr1108 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849223 2.24E-06 NA mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849223 1.68E-06 NA mr1234 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849223 1.36E-08 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849223 6.20E-08 NA mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849223 2.52E-06 NA mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849223 NA 5.66E-06 mr1386_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849223 2.24E-06 NA mr1583_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610849223 NA 1.33E-07 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251