\
| Variant ID: vg0610832091 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10832091 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGCACGACCGTGACGTTCATCACCGTTAGCCATCTGTTCTTCTCTAGCAATTCCTCTGGCAGCAACAGGACGATGACAACGACGGATGCCACGAAGAAAA[C/A,T]
GGAGTTGCTGTAGAAGAAAATGTGGTAACAGTGCCTCGATCATATTGTCATGCATAACCGAGTCCTTGATAGTATAGCCGTTGCTATTATGCTGCCACAC
GTGTGGCAGCATAATAGCAACGGCTATACTATCAAGGACTCGGTTATGCATGACAATATGATCGAGGCACTGTTACCACATTTTCTTCTACAGCAACTCC[G/T,A]
TTTTCTTCGTGGCATCCGTCGTTGTCATCGTCCTGTTGCTGCCAGAGGAATTGCTAGAGAAGAACAGATGGCTAACGGTGATGAACGTCACGGTCGTGCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.50% | 37.00% | 0.44% | 0.00% | T: 0.02% |
| All Indica | 2759 | 96.40% | 2.80% | 0.76% | 0.00% | T: 0.04% |
| All Japonica | 1512 | 11.70% | 88.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 17.10% | 82.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.40% | 0.17% | 0.00% | T: 0.17% |
| Indica II | 465 | 97.40% | 2.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 96.90% | 1.00% | 2.08% | 0.00% | NA |
| Indica Intermediate | 786 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 11.00% | 89.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 15.30% | 84.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 6.60% | 93.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 18.80% | 81.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 40.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610832091 | C -> T | LOC_Os06g19040.1 | downstream_gene_variant ; 1720.0bp to feature; MODIFIER | silent_mutation | Average:50.586; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0610832091 | C -> T | LOC_Os06g19050.1 | intron_variant ; MODIFIER | silent_mutation | Average:50.586; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0610832091 | C -> A | LOC_Os06g19040.1 | downstream_gene_variant ; 1720.0bp to feature; MODIFIER | silent_mutation | Average:50.586; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| vg0610832091 | C -> A | LOC_Os06g19050.1 | intron_variant ; MODIFIER | silent_mutation | Average:50.586; most accessible tissue: Zhenshan97 young leaf, score: 75.039 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610832091 | 2.25E-09 | 1.98E-60 | mr1065 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 1.32E-06 | 1.12E-10 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 4.90E-06 | 1.59E-51 | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | NA | 1.77E-11 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | NA | 6.52E-19 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 1.58E-09 | 7.87E-57 | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 1.98E-06 | 1.50E-09 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 4.68E-09 | 5.33E-45 | mr1091 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 6.69E-06 | NA | mr1091 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 2.89E-08 | 3.94E-51 | mr1108 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 9.88E-08 | 3.74E-37 | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 8.56E-08 | 8.74E-48 | mr1112 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | NA | 7.46E-08 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | NA | 1.92E-14 | mr1218 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | NA | 2.07E-06 | mr1218 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 1.32E-06 | 1.91E-33 | mr1221 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 5.77E-07 | 1.81E-09 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | NA | 1.61E-47 | mr1234 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | NA | 2.41E-09 | mr1242 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | NA | 1.98E-21 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 8.94E-06 | 1.46E-07 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | NA | 2.92E-08 | mr1496 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | NA | 9.36E-44 | mr1526 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | NA | 1.09E-06 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | NA | 4.32E-19 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | NA | 3.63E-09 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 6.72E-08 | 1.88E-29 | mr1877 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 2.11E-06 | NA | mr1877 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | NA | 2.51E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 4.14E-10 | 4.78E-73 | mr1065_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 7.04E-11 | 4.54E-15 | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 1.21E-07 | 1.08E-64 | mr1067_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 3.13E-08 | 3.09E-14 | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 2.21E-10 | 2.27E-69 | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 2.56E-10 | 1.15E-13 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 1.24E-10 | 1.55E-58 | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 7.77E-09 | 1.25E-10 | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 3.76E-10 | 3.37E-68 | mr1108_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 6.22E-09 | 2.51E-13 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 1.95E-08 | 3.14E-44 | mr1110_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 6.67E-07 | 1.19E-07 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 1.71E-10 | 3.93E-68 | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 2.69E-10 | 6.00E-12 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | NA | 1.40E-12 | mr1147_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | NA | 1.12E-35 | mr1221_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 3.16E-09 | 1.14E-68 | mr1234_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 4.61E-08 | 9.72E-13 | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 2.97E-10 | 8.50E-63 | mr1526_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | 6.79E-10 | 4.16E-13 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | NA | 3.09E-07 | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610832091 | NA | 5.48E-27 | mr1877_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |