\
| Variant ID: vg0610802239 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10802239 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 213. )
ATTCTAAAATAAGCCAATATATAATTGGATGGGTTATATCGCATCCAATCTTTTGGTAAGGAGTATCCGAGTTACTCAGTTAACCACTTAACCCCGTCTC[T/C]
GTGGAGAAAATTGTGATTTTGCTATCACAAAAGGATGGTTTCGCTGGAATACTCTCCCTTCAAAGTGATTCATTAAAATGCTATCCTAAACTAAGGGGTA
TACCCCTTAGTTTAGGATAGCATTTTAATGAATCACTTTGAAGGGAGAGTATTCCAGCGAAACCATCCTTTTGTGATAGCAAAATCACAATTTTCTCCAC[A/G]
GAGACGGGGTTAAGTGGTTAACTGAGTAACTCGGATACTCCTTACCAAAAGATTGGATGCGATATAACCCATCCAATTATATATTGGCTTATTTTAGAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.20% | 21.60% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 67.10% | 32.70% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 97.40% | 2.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 81.40% | 18.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 75.90% | 23.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 43.20% | 56.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 66.70% | 33.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 4.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 17.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610802239 | T -> C | LOC_Os06g18970.1 | upstream_gene_variant ; 3590.0bp to feature; MODIFIER | silent_mutation | Average:52.551; most accessible tissue: Zhenshan97 young leaf, score: 61.964 | N | N | N | N |
| vg0610802239 | T -> C | LOC_Os06g18980.1 | upstream_gene_variant ; 773.0bp to feature; MODIFIER | silent_mutation | Average:52.551; most accessible tissue: Zhenshan97 young leaf, score: 61.964 | N | N | N | N |
| vg0610802239 | T -> C | LOC_Os06g18990.1 | downstream_gene_variant ; 4112.0bp to feature; MODIFIER | silent_mutation | Average:52.551; most accessible tissue: Zhenshan97 young leaf, score: 61.964 | N | N | N | N |
| vg0610802239 | T -> C | LOC_Os06g18970-LOC_Os06g18980 | intergenic_region ; MODIFIER | silent_mutation | Average:52.551; most accessible tissue: Zhenshan97 young leaf, score: 61.964 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610802239 | 5.27E-06 | NA | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610802239 | 1.16E-06 | NA | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610802239 | NA | 1.87E-06 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610802239 | NA | 9.14E-06 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610802239 | NA | 6.58E-09 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610802239 | 1.87E-09 | NA | mr1090_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610802239 | 3.27E-10 | NA | mr1211_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610802239 | NA | 1.42E-07 | mr1218_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610802239 | NA | 1.67E-07 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610802239 | NA | 9.64E-06 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610802239 | NA | 3.36E-09 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610802239 | NA | 2.33E-08 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |