Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610802239:

Variant ID: vg0610802239 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10802239
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCTAAAATAAGCCAATATATAATTGGATGGGTTATATCGCATCCAATCTTTTGGTAAGGAGTATCCGAGTTACTCAGTTAACCACTTAACCCCGTCTC[T/C]
GTGGAGAAAATTGTGATTTTGCTATCACAAAAGGATGGTTTCGCTGGAATACTCTCCCTTCAAAGTGATTCATTAAAATGCTATCCTAAACTAAGGGGTA

Reverse complement sequence

TACCCCTTAGTTTAGGATAGCATTTTAATGAATCACTTTGAAGGGAGAGTATTCCAGCGAAACCATCCTTTTGTGATAGCAAAATCACAATTTTCTCCAC[A/G]
GAGACGGGGTTAAGTGGTTAACTGAGTAACTCGGATACTCCTTACCAAAAGATTGGATGCGATATAACCCATCCAATTATATATTGGCTTATTTTAGAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.20%	21.60%	0.15%	0.00%	NA
All Indica	2759	67.10%	32.70%	0.14%	0.00%	NA
All Japonica	1512	97.40%	2.50%	0.07%	0.00%	NA
Aus	269	81.40%	18.20%	0.37%	0.00%	NA
Indica I	595	97.60%	2.40%	0.00%	0.00%	NA
Indica II	465	75.90%	23.70%	0.43%	0.00%	NA
Indica III	913	43.20%	56.70%	0.11%	0.00%	NA
Indica Intermediate	786	66.70%	33.20%	0.13%	0.00%	NA
Temperate Japonica	767	97.10%	2.90%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	95.00%	4.60%	0.41%	0.00%	NA
VI/Aromatic	96	81.20%	17.70%	1.04%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610802239	T -> C	LOC_Os06g18970.1	upstream_gene_variant ; 3590.0bp to feature; MODIFIER	silent_mutation	Average:52.551; most accessible tissue: Zhenshan97 young leaf, score: 61.964	N	N	N	N
vg0610802239	T -> C	LOC_Os06g18980.1	upstream_gene_variant ; 773.0bp to feature; MODIFIER	silent_mutation	Average:52.551; most accessible tissue: Zhenshan97 young leaf, score: 61.964	N	N	N	N
vg0610802239	T -> C	LOC_Os06g18990.1	downstream_gene_variant ; 4112.0bp to feature; MODIFIER	silent_mutation	Average:52.551; most accessible tissue: Zhenshan97 young leaf, score: 61.964	N	N	N	N
vg0610802239	T -> C	LOC_Os06g18970-LOC_Os06g18980	intergenic_region ; MODIFIER	silent_mutation	Average:52.551; most accessible tissue: Zhenshan97 young leaf, score: 61.964	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610802239	5.27E-06	NA	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239	1.16E-06	NA	mr1211	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239	NA	1.87E-06	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239	NA	9.14E-06	mr1422	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239	NA	6.58E-09	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239	1.87E-09	NA	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239	3.27E-10	NA	mr1211_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239	NA	1.42E-07	mr1218_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239	NA	1.67E-07	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239	NA	9.64E-06	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239	NA	3.36E-09	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239	NA	2.33E-08	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251