\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610802239:

Variant ID: vg0610802239 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10802239
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCTAAAATAAGCCAATATATAATTGGATGGGTTATATCGCATCCAATCTTTTGGTAAGGAGTATCCGAGTTACTCAGTTAACCACTTAACCCCGTCTC[T/C]
GTGGAGAAAATTGTGATTTTGCTATCACAAAAGGATGGTTTCGCTGGAATACTCTCCCTTCAAAGTGATTCATTAAAATGCTATCCTAAACTAAGGGGTA

Reverse complement sequence

TACCCCTTAGTTTAGGATAGCATTTTAATGAATCACTTTGAAGGGAGAGTATTCCAGCGAAACCATCCTTTTGTGATAGCAAAATCACAATTTTCTCCAC[A/G]
GAGACGGGGTTAAGTGGTTAACTGAGTAACTCGGATACTCCTTACCAAAAGATTGGATGCGATATAACCCATCCAATTATATATTGGCTTATTTTAGAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.20% 21.60% 0.15% 0.00% NA
All Indica  2759 67.10% 32.70% 0.14% 0.00% NA
All Japonica  1512 97.40% 2.50% 0.07% 0.00% NA
Aus  269 81.40% 18.20% 0.37% 0.00% NA
Indica I  595 97.60% 2.40% 0.00% 0.00% NA
Indica II  465 75.90% 23.70% 0.43% 0.00% NA
Indica III  913 43.20% 56.70% 0.11% 0.00% NA
Indica Intermediate  786 66.70% 33.20% 0.13% 0.00% NA
Temperate Japonica  767 97.10% 2.90% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 4.60% 0.41% 0.00% NA
VI/Aromatic  96 81.20% 17.70% 1.04% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610802239 T -> C LOC_Os06g18970.1 upstream_gene_variant ; 3590.0bp to feature; MODIFIER silent_mutation Average:52.551; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N
vg0610802239 T -> C LOC_Os06g18980.1 upstream_gene_variant ; 773.0bp to feature; MODIFIER silent_mutation Average:52.551; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N
vg0610802239 T -> C LOC_Os06g18990.1 downstream_gene_variant ; 4112.0bp to feature; MODIFIER silent_mutation Average:52.551; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N
vg0610802239 T -> C LOC_Os06g18970-LOC_Os06g18980 intergenic_region ; MODIFIER silent_mutation Average:52.551; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610802239 5.27E-06 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239 1.16E-06 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239 NA 1.87E-06 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239 NA 9.14E-06 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239 NA 6.58E-09 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239 1.87E-09 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239 3.27E-10 NA mr1211_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239 NA 1.42E-07 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239 NA 1.67E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239 NA 9.64E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239 NA 3.36E-09 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610802239 NA 2.33E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251