\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610792532:

Variant ID: vg0610792532 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10792532
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TCCCACCTCTCTCTCTCTCTTCCCCACTTTCCTCTCAATCTCTCTCTCTTCCCCTCTTCCTCTCAATCTCTCTCTGTCTGCGGGCGTGCACGGGGGCGGG[C/T]
GGCGGACGGCGGCGTCGCGGCGACGGCCGAGCGGAGGCAACCGCGGCGCGCCCACCTCTACGACGAGCTGAGCACAAGGTCGGGCAACACATTCACCATC

Reverse complement sequence

GATGGTGAATGTGTTGCCCGACCTTGTGCTCAGCTCGTCGTAGAGGTGGGCGCGCCGCGGTTGCCTCCGCTCGGCCGTCGCCGCGACGCCGCCGTCCGCC[G/A]
CCCGCCCCCGTGCACGCCCGCAGACAGAGAGAGATTGAGAGGAAGAGGGGAAGAGAGAGAGATTGAGAGGAAAGTGGGGAAGAGAGAGAGAGAGGTGGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.10% 30.80% 0.74% 0.38% NA
All Indica  2759 50.20% 48.10% 1.05% 0.65% NA
All Japonica  1512 93.70% 6.10% 0.20% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 22.00% 76.00% 2.02% 0.00% NA
Indica II  465 28.00% 71.40% 0.65% 0.00% NA
Indica III  913 76.00% 21.80% 0.66% 1.53% NA
Indica Intermediate  786 54.60% 43.90% 1.02% 0.51% NA
Temperate Japonica  767 95.40% 4.30% 0.26% 0.00% NA
Tropical Japonica  504 90.30% 9.50% 0.20% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 62.20% 35.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610792532 C -> T LOC_Os06g18970.1 intron_variant ; MODIFIER silent_mutation Average:84.512; most accessible tissue: Zhenshan97 young leaf, score: 94.037 N N N N
vg0610792532 C -> DEL N N silent_mutation Average:84.512; most accessible tissue: Zhenshan97 young leaf, score: 94.037 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0610792532 C T -0.06 -0.04 -0.03 -0.06 -0.06 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610792532 9.32E-07 NA mr1221_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610792532 2.25E-06 NA mr1221_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610792532 NA 6.34E-08 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610792532 7.79E-06 NA mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610792532 NA 8.36E-07 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251