\
| Variant ID: vg0610778838 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 10778838 |
| Reference Allele: T | Alternative Allele: C,TA |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.24, others allele: 0.00, population size: 99. )
GCATTTGTATTGTCAAAATCCATTCTATTTAGTACAGAAATAGTAGATTGCACTACTACAGAATACGTCTTTGCAGACAGACGGCAACGATTTTCGCATG[T/C,TA]
GGCTAGGCCAGCCGCATGCGCGAAAACGTCTGCAAAGATTGTCATCTTTGCATACGGCTAGAGCGACCGCATGCAAAAATCCAATTTTTGCATGCGGTCC
GGACCGCATGCAAAAATTGGATTTTTGCATGCGGTCGCTCTAGCCGTATGCAAAGATGACAATCTTTGCAGACGTTTTCGCGCATGCGGCTGGCCTAGCC[A/G,TA]
CATGCGAAAATCGTTGCCGTCTGTCTGCAAAGACGTATTCTGTAGTAGTGCAATCTACTATTTCTGTACTAAATAGAATGGATTTTGACAATACAAATGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.10% | 30.70% | 0.13% | 0.00% | TA: 0.06% |
| All Indica | 2759 | 52.70% | 47.00% | 0.22% | 0.00% | TA: 0.11% |
| All Japonica | 1512 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 81.80% | 18.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.20% | 14.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 75.10% | 24.50% | 0.43% | 0.00% | NA |
| Indica III | 913 | 22.80% | 76.70% | 0.22% | 0.00% | TA: 0.33% |
| Indica Intermediate | 786 | 49.50% | 50.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610778838 | T -> C | LOC_Os06g18950.1 | upstream_gene_variant ; 3957.0bp to feature; MODIFIER | silent_mutation | Average:58.463; most accessible tissue: Zhenshan97 young leaf, score: 81.841 | N | N | N | N |
| vg0610778838 | T -> C | LOC_Os06g18960.1 | downstream_gene_variant ; 1961.0bp to feature; MODIFIER | silent_mutation | Average:58.463; most accessible tissue: Zhenshan97 young leaf, score: 81.841 | N | N | N | N |
| vg0610778838 | T -> C | LOC_Os06g18950-LOC_Os06g18960 | intergenic_region ; MODIFIER | silent_mutation | Average:58.463; most accessible tissue: Zhenshan97 young leaf, score: 81.841 | N | N | N | N |
| vg0610778838 | T -> TA | LOC_Os06g18950.1 | upstream_gene_variant ; 3958.0bp to feature; MODIFIER | silent_mutation | Average:58.463; most accessible tissue: Zhenshan97 young leaf, score: 81.841 | N | N | N | N |
| vg0610778838 | T -> TA | LOC_Os06g18960.1 | downstream_gene_variant ; 1960.0bp to feature; MODIFIER | silent_mutation | Average:58.463; most accessible tissue: Zhenshan97 young leaf, score: 81.841 | N | N | N | N |
| vg0610778838 | T -> TA | LOC_Os06g18950-LOC_Os06g18960 | intergenic_region ; MODIFIER | silent_mutation | Average:58.463; most accessible tissue: Zhenshan97 young leaf, score: 81.841 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610778838 | 4.89E-08 | 3.02E-10 | mr1020 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 6.16E-09 | 6.16E-09 | mr1032 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 1.25E-06 | NA | mr1065 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 3.94E-11 | 2.93E-21 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 5.53E-08 | 7.83E-18 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | NA | 2.72E-07 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 2.76E-07 | 3.92E-12 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 1.66E-11 | NA | mr1091 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 2.69E-14 | 5.20E-28 | mr1091 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | NA | 1.29E-07 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 2.33E-06 | NA | mr1108 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 1.20E-08 | 2.35E-17 | mr1108 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 1.40E-08 | NA | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 2.35E-09 | 1.21E-16 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 6.43E-07 | NA | mr1112 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 1.57E-08 | 1.10E-17 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 1.67E-06 | 1.67E-06 | mr1165 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | NA | 3.06E-07 | mr1215 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 3.94E-09 | 1.99E-15 | mr1218 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 1.47E-07 | 1.53E-14 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 3.98E-07 | NA | mr1234 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 3.72E-08 | 3.60E-18 | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | NA | 1.00E-06 | mr1242 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 1.24E-06 | 3.53E-12 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | NA | 2.38E-08 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 3.42E-07 | NA | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 6.63E-09 | 7.52E-19 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 8.57E-07 | NA | mr1877 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 1.50E-08 | 4.96E-12 | mr1877 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 5.56E-07 | 3.84E-10 | mr1971 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 3.85E-07 | NA | mr1065_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 6.41E-15 | 2.09E-25 | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 6.93E-06 | NA | mr1067_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 9.57E-12 | 1.73E-19 | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 3.46E-06 | 2.01E-09 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | NA | 7.25E-06 | mr1078_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 2.43E-09 | 1.53E-13 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 9.10E-12 | NA | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 4.18E-16 | 5.47E-29 | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | NA | 1.68E-06 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 6.01E-07 | NA | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 3.08E-11 | 8.84E-20 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 8.69E-09 | NA | mr1110_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 8.03E-11 | 8.34E-18 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 8.89E-10 | NA | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 3.24E-13 | 3.57E-22 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 6.05E-13 | 1.33E-15 | mr1165_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 1.89E-06 | 1.88E-06 | mr1197_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | NA | 1.02E-06 | mr1197_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | NA | 2.80E-07 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 4.18E-06 | NA | mr1218_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 1.86E-07 | 2.22E-19 | mr1218_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 3.30E-09 | 7.50E-22 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 2.15E-10 | NA | mr1234_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 1.29E-12 | 1.77E-21 | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | NA | 4.45E-09 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | NA | 2.97E-11 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 2.68E-07 | 2.68E-07 | mr1477_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 3.76E-06 | 4.40E-11 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 9.68E-08 | NA | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 2.64E-08 | 1.71E-19 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 3.42E-07 | 1.31E-18 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 4.19E-06 | 4.20E-11 | mr1877_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610778838 | 9.65E-08 | 9.65E-08 | mr1971_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |