\
| Variant ID: vg0610774978 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10774978 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 259. )
CCATGAGGGAGAATTATTGGCTGACTTCTTAATTCAGTCCCACCGGGCGTGCCAAAAGCGTGTTGACAGAAAACACGAGGCCTAGGAGATCTGCTTAACT[T/C]
CAGTGCAGGTCCAAAGCTCGCCTTCGGATGTATGAGCGTGCCAGTTGATTTGATCCTGCAATCAACAAGAAACATAGACAAAGAAACCACAGTTAAACCT
AGGTTTAACTGTGGTTTCTTTGTCTATGTTTCTTGTTGATTGCAGGATCAAATCAACTGGCACGCTCATACATCCGAAGGCGAGCTTTGGACCTGCACTG[A/G]
AGTTAAGCAGATCTCCTAGGCCTCGTGTTTTCTGTCAACACGCTTTTGGCACGCCCGGTGGGACTGAATTAAGAAGTCAGCCAATAATTCTCCCTCATGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.70% | 31.10% | 0.04% | 0.15% | NA |
| All Indica | 2759 | 52.10% | 47.60% | 0.00% | 0.25% | NA |
| All Japonica | 1512 | 95.40% | 4.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 81.40% | 18.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.70% | 15.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 73.80% | 24.90% | 0.00% | 1.29% | NA |
| Indica III | 913 | 22.60% | 77.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 49.00% | 50.90% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 97.00% | 2.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 93.30% | 6.50% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610774978 | T -> C | LOC_Os06g18950.1 | upstream_gene_variant ; 97.0bp to feature; MODIFIER | silent_mutation | Average:43.233; most accessible tissue: Zhenshan97 young leaf, score: 59.009 | N | N | N | N |
| vg0610774978 | T -> C | LOC_Os06g18950-LOC_Os06g18960 | intergenic_region ; MODIFIER | silent_mutation | Average:43.233; most accessible tissue: Zhenshan97 young leaf, score: 59.009 | N | N | N | N |
| vg0610774978 | T -> DEL | N | N | silent_mutation | Average:43.233; most accessible tissue: Zhenshan97 young leaf, score: 59.009 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610774978 | 9.83E-08 | 3.05E-10 | mr1020 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 3.47E-09 | 3.47E-09 | mr1032 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 3.29E-07 | NA | mr1065 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 7.88E-14 | 9.20E-23 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 2.37E-06 | NA | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 1.55E-09 | 5.84E-19 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | NA | 2.73E-07 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 7.41E-07 | 9.46E-07 | mr1078 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 2.12E-09 | 8.73E-14 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 1.94E-11 | NA | mr1091 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 7.53E-17 | 2.10E-28 | mr1091 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | NA | 2.63E-08 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 6.42E-09 | 7.36E-18 | mr1108 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 1.85E-08 | NA | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 6.36E-11 | 1.97E-17 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 7.00E-07 | NA | mr1112 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 5.23E-11 | 6.64E-19 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | NA | 5.28E-08 | mr1215 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 2.99E-06 | NA | mr1218 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 2.11E-11 | 1.04E-17 | mr1218 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 7.99E-11 | 5.04E-18 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 4.78E-07 | NA | mr1234 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 1.21E-09 | 2.53E-19 | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | NA | 7.94E-07 | mr1242 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | NA | 5.79E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 2.12E-07 | 5.10E-13 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | NA | 6.63E-09 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 3.17E-07 | NA | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 3.56E-10 | 2.26E-20 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 2.22E-08 | 2.35E-11 | mr1877 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 2.09E-07 | 1.78E-10 | mr1971 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 3.49E-08 | NA | mr1065_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 4.22E-15 | 2.94E-25 | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 2.01E-07 | NA | mr1067_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 4.24E-12 | 2.83E-20 | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 3.94E-06 | 1.29E-09 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 2.18E-09 | 4.05E-14 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 3.91E-10 | NA | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 4.41E-15 | 1.67E-27 | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | NA | 1.19E-06 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 1.73E-06 | NA | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 4.39E-12 | 3.84E-20 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 2.48E-08 | NA | mr1110_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 3.68E-10 | 7.79E-18 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 1.86E-08 | NA | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 1.48E-12 | 1.29E-21 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 2.62E-07 | 6.97E-10 | mr1165_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 6.07E-06 | 6.04E-06 | mr1197_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | NA | 3.20E-07 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 5.97E-06 | NA | mr1218_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 1.36E-07 | 7.16E-20 | mr1218_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | NA | 4.63E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 1.62E-09 | 1.43E-22 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 3.20E-09 | NA | mr1234_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 7.13E-12 | 2.51E-21 | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | NA | 2.76E-09 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | NA | 2.16E-11 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 5.58E-08 | 5.07E-13 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 1.26E-07 | NA | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 3.59E-08 | 2.24E-19 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 7.65E-06 | NA | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | 7.12E-08 | 4.85E-19 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610774978 | NA | 2.68E-09 | mr1877_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |