\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610752667:

Variant ID: vg0610752667 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10752667
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TAACTAAACTATCAACTCAATTGCTCTGAAAGCGATACAAAAGCGATACCGGGAAGCCTCACGCTCCCCTTCTATTTATACATGAGGTAGGCAGCCTAAA[G/T]
CCACGAACCAAATTCGTACTAAGAGTCCTAAACACCTTAGGAAACCCTCTAGTACAAAAAATAAACTTTACATAACCAATCGTAGCAAATTTGGACTCCT

Reverse complement sequence

AGGAGTCCAAATTTGCTACGATTGGTTATGTAAAGTTTATTTTTTGTACTAGAGGGTTTCCTAAGGTGTTTAGGACTCTTAGTACGAATTTGGTTCGTGG[C/A]
TTTAGGCTGCCTACCTCATGTATAAATAGAAGGGGAGCGTGAGGCTTCCCGGTATCGCTTTTGTATCGCTTTCAGAGCAATTGAGTTGATAGTTTAGTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 10.30% 0.00% 0.00% NA
All Indica  2759 85.90% 14.10% 0.00% 0.00% NA
All Japonica  1512 94.60% 5.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 90.40% 9.60% 0.00% 0.00% NA
Indica II  465 85.60% 14.40% 0.00% 0.00% NA
Indica III  913 83.20% 16.80% 0.00% 0.00% NA
Indica Intermediate  786 85.60% 14.40% 0.00% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 86.10% 13.90% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610752667 G -> T LOC_Os06g18930.1 upstream_gene_variant ; 3707.0bp to feature; MODIFIER silent_mutation Average:40.776; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0610752667 G -> T LOC_Os06g18920.1 downstream_gene_variant ; 2957.0bp to feature; MODIFIER silent_mutation Average:40.776; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N
vg0610752667 G -> T LOC_Os06g18920-LOC_Os06g18930 intergenic_region ; MODIFIER silent_mutation Average:40.776; most accessible tissue: Minghui63 flag leaf, score: 55.781 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610752667 3.15E-18 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 7.17E-12 5.04E-13 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 2.34E-12 2.34E-12 mr1068 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 2.66E-09 NA mr1078 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 3.54E-10 2.79E-11 mr1078 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 NA 2.29E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 1.12E-21 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 6.26E-16 8.52E-23 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 8.38E-13 2.92E-15 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 5.75E-11 NA mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 2.44E-06 NA mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 6.34E-10 2.51E-11 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 7.49E-10 NA mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 6.89E-06 NA mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 7.64E-09 1.15E-10 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 1.90E-18 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 4.82E-11 6.05E-10 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 2.52E-11 3.75E-11 mr1111 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 1.12E-12 NA mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 3.79E-08 1.86E-09 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 2.57E-09 1.91E-12 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 NA 1.97E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 6.45E-17 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 3.57E-12 3.00E-09 mr1144 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 8.08E-09 8.08E-09 mr1144 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 6.16E-09 NA mr1200 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 5.31E-07 5.35E-08 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 3.50E-31 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 2.88E-23 7.67E-32 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 4.60E-14 1.47E-15 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 4.12E-06 NA mr1244 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 NA 2.05E-07 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 1.52E-17 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 3.57E-09 8.55E-12 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 5.44E-14 5.77E-17 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 1.65E-08 NA mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 1.07E-12 2.82E-15 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 1.56E-06 NA mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 3.98E-22 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 5.32E-16 4.85E-27 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 1.71E-16 5.22E-21 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 2.26E-12 NA mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 1.89E-06 1.41E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 1.63E-10 1.41E-12 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 1.62E-11 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 4.68E-06 1.13E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 3.99E-09 3.47E-11 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 7.65E-06 7.65E-06 mr1108_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 5.44E-06 6.49E-07 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 4.09E-16 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 2.83E-09 8.92E-10 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 1.03E-11 1.03E-11 mr1111_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 2.84E-06 2.13E-07 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 1.60E-14 NA mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 2.59E-07 2.03E-12 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 6.51E-09 1.11E-11 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 1.23E-14 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 8.82E-09 7.90E-09 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 1.20E-09 1.89E-10 mr1144_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 9.49E-09 NA mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 5.00E-07 3.65E-09 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 3.44E-30 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 1.54E-21 4.69E-36 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 9.55E-16 1.48E-18 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 2.23E-06 2.23E-06 mr1234_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752667 NA 9.04E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251