\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610749134:

Variant ID: vg0610749134 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10749134
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.04, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ACCCGCCAGGTGGCCTGCACATAGAACAGTGAGATAGAAGAGGAAGGGAGGGAAGAGAGGGTGATGACGTGTCACCCTGACATGTGGGGCCCACATGGGT[C/T]
CCATGCTGACTCAGCTGCCACATTGGATAAAACCGGGGTCAAAACCGCCCGAGGACCTAAAGTGACCCGGTTTTGTAAATTCGAGGGATGACATATATAT

Reverse complement sequence

ATATATATGTCATCCCTCGAATTTACAAAACCGGGTCACTTTAGGTCCTCGGGCGGTTTTGACCCCGGTTTTATCCAATGTGGCAGCTGAGTCAGCATGG[G/A]
ACCCATGTGGGCCCCACATGTCAGGGTGACACGTCATCACCCTCTCTTCCCTCCCTTCCTCTTCTATCTCACTGTTCTATGTGCAGGCCACCTGGCGGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.00% 11.20% 0.76% 1.02% NA
All Indica  2759 81.10% 15.90% 1.27% 1.70% NA
All Japonica  1512 94.90% 5.00% 0.00% 0.07% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 81.30% 14.80% 3.03% 0.84% NA
Indica II  465 90.10% 1.70% 1.72% 6.45% NA
Indica III  913 76.60% 23.10% 0.11% 0.22% NA
Indica Intermediate  786 80.80% 16.90% 1.02% 1.27% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 85.70% 14.30% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 85.60% 13.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610749134 C -> T LOC_Os06g18910.1 downstream_gene_variant ; 4675.0bp to feature; MODIFIER silent_mutation Average:65.124; most accessible tissue: Zhenshan97 young leaf, score: 88.127 N N N N
vg0610749134 C -> T LOC_Os06g18920.1 intron_variant ; MODIFIER silent_mutation Average:65.124; most accessible tissue: Zhenshan97 young leaf, score: 88.127 N N N N
vg0610749134 C -> DEL N N silent_mutation Average:65.124; most accessible tissue: Zhenshan97 young leaf, score: 88.127 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610749134 4.64E-06 5.23E-12 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610749134 NA 1.03E-09 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610749134 NA 6.55E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610749134 NA 2.33E-07 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610749134 NA 2.58E-06 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610749134 4.98E-06 NA mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610749134 6.25E-06 1.37E-07 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610749134 9.14E-08 4.14E-10 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610749134 3.91E-06 NA mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610749134 6.54E-06 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610749134 8.38E-08 6.60E-14 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610749134 5.12E-06 NA mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610749134 7.20E-06 2.38E-11 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610749134 6.74E-06 9.09E-10 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610749134 NA 6.10E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610749134 NA 2.66E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610749134 1.16E-06 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610749134 4.63E-06 NA mr1570_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610749134 6.51E-06 NA mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251