\
| Variant ID: vg0610738394 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10738394 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 268. )
TACTAATAGCTCACTCGAGAAAGGAACATGAATGCTCGAAAAATAAAGCAAGCTATACCTGAACTTATATGGCACTATGGCAAAGATAAAACTCTGCATC[G/A]
GAAAAAAAAAATCCTGACATGTAACTATTCCAATAGACAAAAGTGGCAGTCATATGCAAGTATGCAACGACAAAAATAATGGGAACAATATTTGTGGCCT
AGGCCACAAATATTGTTCCCATTATTTTTGTCGTTGCATACTTGCATATGACTGCCACTTTTGTCTATTGGAATAGTTACATGTCAGGATTTTTTTTTTC[C/T]
GATGCAGAGTTTTATCTTTGCCATAGTGCCATATAAGTTCAGGTATAGCTTGCTTTATTTTTCGAGCATTCATGTTCCTTTCTCGAGTGAGCTATTAGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.20% | 0.20% | 0.57% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 98.30% | 0.00% | 1.72% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.60% | 0.00% | 3.39% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610738394 | G -> A | LOC_Os06g18910.1 | upstream_gene_variant ; 4737.0bp to feature; MODIFIER | silent_mutation | Average:55.22; most accessible tissue: Callus, score: 72.503 | N | N | N | N |
| vg0610738394 | G -> A | LOC_Os06g18900.1 | downstream_gene_variant ; 298.0bp to feature; MODIFIER | silent_mutation | Average:55.22; most accessible tissue: Callus, score: 72.503 | N | N | N | N |
| vg0610738394 | G -> A | LOC_Os06g18890-LOC_Os06g18900 | intergenic_region ; MODIFIER | silent_mutation | Average:55.22; most accessible tissue: Callus, score: 72.503 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610738394 | 1.12E-07 | NA | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610738394 | NA | 7.56E-08 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610738394 | 4.80E-11 | NA | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610738394 | 1.04E-07 | NA | mr1111 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610738394 | 9.88E-06 | NA | mr1121 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610738394 | NA | 1.89E-06 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610738394 | 1.45E-07 | NA | mr1144 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610738394 | 8.21E-15 | NA | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610738394 | 3.68E-07 | 1.55E-09 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610738394 | 2.85E-07 | NA | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610738394 | 4.27E-10 | NA | mr1090_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610738394 | NA | 8.67E-07 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610738394 | 7.46E-06 | NA | mr1111_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610738394 | NA | 1.84E-06 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610738394 | 6.26E-13 | NA | mr1211_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610738394 | 9.25E-06 | 6.38E-09 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |