\
| Variant ID: vg0610736522 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10736522 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )
AAGATGAAGTAAAGTGAAGATTAGGGTTTCGTTCTGGTTTCCAGCCGTCGCCTGTGGTGTTGGGTGTTAGTCCGTTGGTTCCGCTGCTGTTGCTATAGTT[G/T]
GTGTTTCCTCATCTGCGTCGTCGGTTGCATTTCTCAGGCTATTCTGAGCTGCAACCTAAGATAAGGTAAATAAGTCCTCTATTTATTTTACGGTTTGCAA
TTGCAAACCGTAAAATAAATAGAGGACTTATTTACCTTATCTTAGGTTGCAGCTCAGAATAGCCTGAGAAATGCAACCGACGACGCAGATGAGGAAACAC[C/A]
AACTATAGCAACAGCAGCGGAACCAACGGACTAACACCCAACACCACAGGCGACGGCTGGAAACCAGAACGAAACCCTAATCTTCACTTTACTTCATCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.20% | 4.90% | 0.00% | 0.89% | NA |
| All Indica | 2759 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 97.20% | 0.00% | 0.00% | 2.78% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.00% | 12.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.50% | 0.00% | 0.00% | 5.48% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610736522 | G -> T | LOC_Os06g18900.1 | downstream_gene_variant ; 2170.0bp to feature; MODIFIER | silent_mutation | Average:45.116; most accessible tissue: Zhenshan97 root, score: 66.289 | N | N | N | N |
| vg0610736522 | G -> T | LOC_Os06g18890-LOC_Os06g18900 | intergenic_region ; MODIFIER | silent_mutation | Average:45.116; most accessible tissue: Zhenshan97 root, score: 66.289 | N | N | N | N |
| vg0610736522 | G -> DEL | N | N | silent_mutation | Average:45.116; most accessible tissue: Zhenshan97 root, score: 66.289 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610736522 | NA | 5.47E-09 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 1.52E-08 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 1.13E-10 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 5.52E-11 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 5.31E-08 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 5.65E-09 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 6.23E-08 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 2.46E-07 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 5.46E-09 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 1.55E-08 | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 6.73E-14 | mr1244 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 1.69E-10 | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 6.07E-09 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 5.22E-09 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 1.04E-08 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 6.31E-09 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 6.06E-08 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 2.39E-07 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 2.41E-08 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 3.07E-09 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | NA | 3.20E-08 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610736522 | 6.76E-06 | 3.99E-14 | mr1244_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |