\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610723836:

Variant ID: vg0610723836 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 10723836
Reference Allele: GAAlternative Allele: AA,G
Primary Allele: GASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGGTAGGGGAGGGTGGCGCTGGCGTAGTTAGGAGTGGACATTCGATCTGATTGAAAATTTCGGTCTTAATCTTTGGTCTTTCGGTTATTTTAGTCTTT[GA/AA,G]
AAAGTGAAGACCGAATTTCAACGCAAATATGTCATGACCGACAAATTCGGTCTCGGTTCTGACCGAAATTTAACAATATTTTCATATATGCAAAAAAAAA

Reverse complement sequence

TTTTTTTTTGCATATATGAAAATATTGTTAAATTTCGGTCAGAACCGAGACCGAATTTGTCGGTCATGACATATTTGCGTTGAAATTCGGTCTTCACTTT[TC/TT,C]
AAAGACTAAAATAACCGAAAGACCAAAGATTAAGACCGAAATTTTCAATCAGATCGAATGTCCACTCCTAACTACGCCAGCGCCACCCTCCCCTACCAAA

Allele Frequencies:

Populations Population SizeFrequency of GA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.90% 5.00% 0.11% 0.00% G: 0.04%
All Indica  2759 94.70% 5.30% 0.04% 0.00% NA
All Japonica  1512 94.50% 5.30% 0.20% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 88.20% 11.80% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 96.60% 3.40% 0.00% 0.00% NA
Indica Intermediate  786 94.40% 5.50% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 84.50% 14.90% 0.60% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 86.70% 11.10% 0.00% 0.00% G: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610723836 GA -> AA LOC_Os06g18870.1 downstream_gene_variant ; 758.0bp to feature; MODIFIER silent_mutation Average:66.162; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0610723836 GA -> AA LOC_Os06g18880.1 downstream_gene_variant ; 2878.0bp to feature; MODIFIER silent_mutation Average:66.162; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0610723836 GA -> AA LOC_Os06g18860-LOC_Os06g18870 intergenic_region ; MODIFIER silent_mutation Average:66.162; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0610723836 GA -> G LOC_Os06g18870.1 downstream_gene_variant ; 757.0bp to feature; MODIFIER silent_mutation Average:66.162; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0610723836 GA -> G LOC_Os06g18880.1 downstream_gene_variant ; 2877.0bp to feature; MODIFIER silent_mutation Average:66.162; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0610723836 GA -> G LOC_Os06g18860-LOC_Os06g18870 intergenic_region ; MODIFIER silent_mutation Average:66.162; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610723836 7.46E-08 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 3.15E-10 3.15E-10 mr1068 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 NA 9.78E-08 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 2.84E-07 NA mr1078 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 6.99E-11 3.44E-12 mr1078 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 1.11E-12 NA mr1090 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 2.39E-06 NA mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 1.18E-10 4.60E-13 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 1.69E-07 5.94E-09 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 1.41E-07 2.07E-09 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 1.40E-07 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 1.10E-06 2.48E-06 mr1111 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 1.91E-06 2.13E-09 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 NA 1.03E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 3.80E-07 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 4.01E-16 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 4.57E-08 5.07E-10 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 1.66E-11 3.04E-13 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 2.09E-06 2.08E-06 mr1065_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 1.75E-08 NA mr1068_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 2.25E-12 8.08E-15 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 4.12E-07 NA mr1078_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 4.18E-15 1.06E-18 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 1.26E-06 NA mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 1.07E-11 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 NA 3.69E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 7.06E-15 9.71E-19 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 6.43E-06 NA mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 6.92E-10 1.28E-11 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 5.29E-09 2.31E-11 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 4.57E-06 4.57E-06 mr1108_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 6.98E-07 4.64E-08 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 2.98E-07 NA mr1111_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 2.06E-09 2.06E-09 mr1111_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 2.48E-07 8.07E-09 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 3.31E-06 NA mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 2.03E-08 1.56E-11 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 NA 1.56E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 4.50E-06 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 6.31E-07 7.54E-08 mr1144_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 1.74E-07 2.03E-10 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 NA 3.18E-06 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 2.42E-15 NA mr1211_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 1.31E-06 1.23E-09 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 2.25E-14 3.41E-17 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723836 8.03E-07 8.02E-07 mr1234_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251