\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610723416:

Variant ID: vg0610723416 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 10723416
Reference Allele: CAlternative Allele: T,CTA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


AAACTTTTTAGCATTGCTCAAATTCATCTAGATGTTAATGAATCTAGATATCTGTTTTACAATGTAAAAATTTCATATCTAGATATAGATTCATTAATAT[C/T,CTA]
TATATGAATGTGGTCAATGTTAAAAAGTCTTATATTGTGAAACGGAGGAAGTAGTATTTACTGTACTACTCCTATACATGTGAGCCATAGTAGATCTGTA

Reverse complement sequence

TACAGATCTACTATGGCTCACATGTATAGGAGTAGTACAGTAAATACTACTTCCTCCGTTTCACAATATAAGACTTTTTAACATTGACCACATTCATATA[G/A,TAG]
ATATTAATGAATCTATATCTAGATATGAAATTTTTACATTGTAAAACAGATATCTAGATTCATTAACATCTAGATGAATTTGAGCAATGCTAAAAAGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.20% 6.70% 0.00% 0.00% CTA: 0.08%
All Indica  2759 89.10% 10.70% 0.00% 0.00% CTA: 0.14%
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 85.60% 14.40% 0.00% 0.00% NA
Indica III  913 83.20% 16.30% 0.00% 0.00% CTA: 0.44%
Indica Intermediate  786 89.80% 10.20% 0.00% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610723416 C -> CTA LOC_Os06g18870.1 downstream_gene_variant ; 1177.0bp to feature; MODIFIER silent_mutation Average:73.946; most accessible tissue: Zhenshan97 flower, score: 85.727 N N N N
vg0610723416 C -> CTA LOC_Os06g18880.1 downstream_gene_variant ; 3297.0bp to feature; MODIFIER silent_mutation Average:73.946; most accessible tissue: Zhenshan97 flower, score: 85.727 N N N N
vg0610723416 C -> CTA LOC_Os06g18860-LOC_Os06g18870 intergenic_region ; MODIFIER silent_mutation Average:73.946; most accessible tissue: Zhenshan97 flower, score: 85.727 N N N N
vg0610723416 C -> T LOC_Os06g18870.1 downstream_gene_variant ; 1178.0bp to feature; MODIFIER silent_mutation Average:73.946; most accessible tissue: Zhenshan97 flower, score: 85.727 N N N N
vg0610723416 C -> T LOC_Os06g18880.1 downstream_gene_variant ; 3298.0bp to feature; MODIFIER silent_mutation Average:73.946; most accessible tissue: Zhenshan97 flower, score: 85.727 N N N N
vg0610723416 C -> T LOC_Os06g18860-LOC_Os06g18870 intergenic_region ; MODIFIER silent_mutation Average:73.946; most accessible tissue: Zhenshan97 flower, score: 85.727 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0610723416 C CTA -0.1 -0.15 -0.11 -0.08 -0.19 -0.19
vg0610723416 C T 0.04 0.03 0.02 0.01 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610723416 2.87E-09 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 2.75E-08 8.11E-10 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 1.16E-08 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 2.82E-09 5.45E-15 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 1.23E-07 NA mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 1.22E-06 2.25E-08 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 2.62E-06 NA mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 NA 8.30E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 3.41E-08 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 1.75E-06 4.16E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 6.96E-10 NA mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 1.89E-08 2.40E-11 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 NA 3.59E-08 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 1.50E-09 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 2.15E-08 7.53E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 1.07E-06 NA mr1200 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 NA 4.62E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 2.06E-11 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 1.90E-11 2.07E-16 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 2.40E-11 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 8.71E-11 1.19E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 9.92E-12 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 1.73E-13 1.18E-17 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 8.87E-09 NA mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 1.15E-07 1.20E-09 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 5.30E-08 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 4.33E-07 5.92E-08 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 6.00E-10 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 1.34E-09 6.95E-08 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 4.12E-12 NA mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 3.17E-11 7.14E-14 mr1121_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 1.10E-09 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 3.95E-09 1.86E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 1.74E-07 NA mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 3.14E-07 NA mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 7.17E-14 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610723416 2.19E-15 1.33E-20 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251