Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610709208:

Variant ID: vg0610709208 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10709208
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

TTTATATCAAATTACCCGCGTAAAGAATTCGATCCTGTGAATACAACAGGCCCTATATGACAAAATGCATAGGGTACAGAATAATAGAACATGTCACATG[G/A]
ATGGAAGAGTTTCTTACTGTTTCTGATGGAGTGATGGTACCATTGAAGCTCTTCAATATCTCAGCACTGCAGTAACTTTACTTACAGTGCACACGGAACA

Reverse complement sequence

TGTTCCGTGTGCACTGTAAGTAAAGTTACTGCAGTGCTGAGATATTGAAGAGCTTCAATGGTACCATCACTCCATCAGAAACAGTAAGAAACTCTTCCAT[C/T]
CATGTGACATGTTCTATTATTCTGTACCCTATGCATTTTGTCATATAGGGCCTGTTGTATTCACAGGATCGAATTCTTTACGCGGGTAATTTGATATAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.00%	14.00%	0.00%	0.00%	NA
All Indica	2759	77.00%	23.00%	0.00%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	83.90%	16.10%	0.00%	0.00%	NA
Indica II	465	33.80%	66.20%	0.00%	0.00%	NA
Indica III	913	93.80%	6.20%	0.00%	0.00%	NA
Indica Intermediate	786	78.00%	22.00%	0.00%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610709208	G -> A	LOC_Os06g18840.1	downstream_gene_variant ; 1637.0bp to feature; MODIFIER	silent_mutation	Average:61.769; most accessible tissue: Callus, score: 89.519	N	N	N	N
vg0610709208	G -> A	LOC_Os06g18850.1	downstream_gene_variant ; 101.0bp to feature; MODIFIER	silent_mutation	Average:61.769; most accessible tissue: Callus, score: 89.519	N	N	N	N
vg0610709208	G -> A	LOC_Os06g18840-LOC_Os06g18850	intergenic_region ; MODIFIER	silent_mutation	Average:61.769; most accessible tissue: Callus, score: 89.519	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610709208	8.56E-08	NA	mr1065	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	1.24E-06	6.60E-11	mr1065	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	NA	1.06E-08	mr1087	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	7.27E-09	NA	mr1091	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	6.28E-07	9.46E-13	mr1091	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	2.55E-06	NA	mr1108	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	NA	4.91E-09	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	NA	4.63E-08	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	NA	1.07E-13	mr1218	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	NA	3.53E-08	mr1218	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	NA	2.16E-06	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	4.40E-09	NA	mr1234	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	7.39E-07	3.56E-09	mr1234	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	2.02E-07	NA	mr1526	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	NA	2.85E-08	mr1526	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	6.98E-07	1.13E-31	mr1877	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	NA	7.16E-13	mr1877	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	NA	5.07E-06	mr1050_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	3.62E-10	NA	mr1065_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	1.63E-09	3.58E-13	mr1065_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	3.46E-09	NA	mr1067_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	3.64E-08	NA	mr1067_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	4.57E-07	NA	mr1078_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	3.40E-07	2.49E-08	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	8.02E-08	NA	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	2.14E-07	3.64E-11	mr1087_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	1.96E-10	NA	mr1091_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	2.28E-08	3.08E-14	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	4.40E-09	NA	mr1108_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	1.05E-07	NA	mr1108_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	1.98E-08	NA	mr1110_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	4.70E-07	9.64E-13	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	6.21E-09	NA	mr1112_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	9.97E-08	6.60E-11	mr1112_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	NA	1.12E-06	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	8.57E-06	8.56E-06	mr1126_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	NA	5.58E-09	mr1218_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	1.39E-09	NA	mr1234_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	1.53E-07	3.14E-10	mr1234_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	NA	8.61E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	3.08E-07	NA	mr1526_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610709208	6.01E-07	9.73E-10	mr1526_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251