Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610700215:

Variant ID: vg0610700215 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10700215
Reference Allele: AAlternative Allele: C,G
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.64, A: 0.36, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


CGCTAGGCCACGCGAGCACGAGGCTGCGCCGCCCACAGCGTGCGTGACCCGCCTTTTCTCCTCGCTGCGCGCCCTCGTTTTGGCGAGGCTTTGCGTCGCT[A/C,G]
AGGTAGGGGACGACGAACCTAGCTAAGGCGCGGTCCCTCCCTCCACGGCGGCAAAAAACCTACGTGGCATGACTAAGCCACTGTGAGGGGCCTAAGGCCC

Reverse complement sequence

GGGCCTTAGGCCCCTCACAGTGGCTTAGTCATGCCACGTAGGTTTTTTGCCGCCGTGGAGGGAGGGACCGCGCCTTAGCTAGGTTCGTCGTCCCCTACCT[T/G,C]
AGCGACGCAAAGCCTCGCCAAAACGAGGGCGCGCAGCGAGGAGAAAAGGCGGGTCACGCACGCTGTGGGCGGCGCAGCCTCGTGCTCGCGTGGCCTAGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 38.10% 0.21% 0.93% G: 0.02%
All Indica  2759 40.50% 59.20% 0.14% 0.11% NA
All Japonica  1512 92.90% 6.90% 0.13% 0.00% G: 0.07%
Aus  269 82.20% 3.00% 0.74% 14.13% NA
Indica I  595 68.20% 31.60% 0.17% 0.00% NA
Indica II  465 17.40% 82.20% 0.43% 0.00% NA
Indica III  913 33.80% 66.20% 0.00% 0.00% NA
Indica Intermediate  786 41.00% 58.50% 0.13% 0.38% NA
Temperate Japonica  767 98.60% 1.30% 0.13% 0.00% NA
Tropical Japonica  504 83.30% 16.50% 0.00% 0.00% G: 0.20%
Japonica Intermediate  241 95.00% 4.60% 0.41% 0.00% NA
VI/Aromatic  96 84.40% 12.50% 1.04% 2.08% NA
Intermediate  90 51.10% 46.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610700215 A -> C LOC_Os06g18840.1 upstream_gene_variant ; 4708.0bp to feature; MODIFIER silent_mutation Average:75.566; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N
vg0610700215 A -> C LOC_Os06g18830-LOC_Os06g18840 intergenic_region ; MODIFIER silent_mutation Average:75.566; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N
vg0610700215 A -> G LOC_Os06g18840.1 upstream_gene_variant ; 4708.0bp to feature; MODIFIER silent_mutation Average:75.566; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N
vg0610700215 A -> G LOC_Os06g18830-LOC_Os06g18840 intergenic_region ; MODIFIER silent_mutation Average:75.566; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N
vg0610700215 A -> DEL N N silent_mutation Average:75.566; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0610700215 A C 0.01 0.01 0.01 0.07 0.06 0.05
vg0610700215 A G 0.0 0.0 0.01 0.03 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610700215 1.19E-09 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 2.86E-10 2.86E-10 mr1068 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 9.51E-08 NA mr1078 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 2.81E-06 1.89E-07 mr1078 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 3.73E-11 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 NA 9.47E-08 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 4.62E-09 1.49E-11 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 3.05E-08 8.10E-10 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 5.60E-08 6.31E-10 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 3.15E-08 NA mr1111 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 4.25E-09 1.03E-09 mr1111 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 5.83E-08 1.03E-10 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 1.26E-06 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 3.21E-06 3.21E-06 mr1144 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 6.23E-11 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 NA 8.10E-07 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 2.21E-09 4.51E-11 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 3.05E-11 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 2.87E-11 1.91E-13 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 1.54E-10 NA mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 3.22E-09 1.39E-11 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 1.20E-07 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 2.28E-06 NA mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 2.28E-15 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 NA 6.22E-09 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 1.63E-14 1.64E-18 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 1.67E-09 2.83E-11 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 3.79E-08 1.77E-09 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 2.01E-11 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 7.68E-07 NA mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 5.56E-11 5.56E-11 mr1111_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 3.10E-06 3.24E-07 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 3.03E-07 NA mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 5.73E-07 4.63E-09 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 7.80E-10 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 9.58E-06 NA mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 2.39E-08 3.54E-09 mr1144_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 6.57E-07 NA mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 8.10E-07 9.50E-09 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 7.09E-17 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 8.42E-07 2.87E-10 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 2.37E-12 3.43E-14 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 2.85E-06 2.85E-06 mr1234_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 8.26E-06 NA mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 NA 5.13E-06 mr1348_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610700215 4.49E-06 NA mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251