\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610674740:

Variant ID: vg0610674740 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10674740
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.29, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAAACGCCGTGGGGCCTCGGGGCTTGGGGTTGAGAATACGAAGCGCCACGCACGCGAAGTCGCCGCGCGGAGATACGCGCGGACTCGAACAGGGTTCT[G/A,C]
GCGCTCTGGCCTCACACGAATACATGGGCCTTCTTCGGTTGGGCTAATTTTTTGAGGCCCTGTAAATTTGGAGGCCATGTACGGTCGCACGGGCCACACG

Reverse complement sequence

CGTGTGGCCCGTGCGACCGTACATGGCCTCCAAATTTACAGGGCCTCAAAAAATTAGCCCAACCGAAGAAGGCCCATGTATTCGTGTGAGGCCAGAGCGC[C/T,G]
AGAACCCTGTTCGAGTCCGCGCGTATCTCCGCGCGGCGACTTCGCGTGCGTGGCGCTTCGTATTCTCAACCCCAAGCCCCGAGGCCCCACGGCGTTTTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.60% 44.20% 3.66% 6.56% NA
All Indica  2759 56.10% 35.40% 2.94% 5.51% NA
All Japonica  1512 33.40% 58.50% 3.11% 5.03% NA
Aus  269 17.80% 38.30% 15.24% 28.62% NA
Indica I  595 70.30% 20.50% 5.71% 3.53% NA
Indica II  465 59.40% 23.70% 4.95% 12.04% NA
Indica III  913 41.00% 54.10% 1.10% 3.83% NA
Indica Intermediate  786 61.20% 31.90% 1.78% 5.09% NA
Temperate Japonica  767 53.10% 44.10% 2.61% 0.26% NA
Tropical Japonica  504 10.30% 76.20% 2.58% 10.91% NA
Japonica Intermediate  241 19.10% 67.20% 5.81% 7.88% NA
VI/Aromatic  96 4.20% 92.70% 2.08% 1.04% NA
Intermediate  90 55.60% 37.80% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610674740 G -> C LOC_Os06g18800.1 upstream_gene_variant ; 2255.0bp to feature; MODIFIER N Average:73.054; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0610674740 G -> C LOC_Os06g18800-LOC_Os06g18810 intergenic_region ; MODIFIER N Average:73.054; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0610674740 G -> A LOC_Os06g18800.1 upstream_gene_variant ; 2255.0bp to feature; MODIFIER silent_mutation Average:73.054; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0610674740 G -> A LOC_Os06g18800-LOC_Os06g18810 intergenic_region ; MODIFIER silent_mutation Average:73.054; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N
vg0610674740 G -> DEL N N silent_mutation Average:73.054; most accessible tissue: Zhenshan97 panicle, score: 85.665 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610674740 1.77E-08 4.30E-12 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 3.96E-06 NA mr1067 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 2.15E-08 2.94E-14 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 1.97E-11 4.94E-12 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 NA 1.87E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 1.46E-09 1.23E-14 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 1.02E-08 3.77E-13 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 8.52E-06 9.76E-09 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 2.18E-07 1.80E-10 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 NA 2.46E-08 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 NA 3.13E-06 mr1215 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 1.29E-06 NA mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 9.37E-10 1.96E-12 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 3.79E-07 NA mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 1.51E-09 9.68E-16 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 7.75E-07 1.17E-11 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 NA 2.77E-08 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 1.97E-07 4.54E-12 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 3.92E-06 6.01E-08 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 5.64E-11 1.71E-17 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 7.80E-07 1.35E-08 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 3.67E-06 NA mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 1.82E-12 1.67E-16 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 1.10E-13 3.44E-18 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 6.13E-06 NA mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 8.00E-06 NA mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 1.68E-16 8.58E-17 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 1.01E-06 1.59E-11 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 6.77E-13 2.01E-17 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 5.18E-13 4.58E-17 mr1108_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 5.33E-09 1.63E-11 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 5.86E-15 2.02E-17 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 1.96E-08 3.92E-11 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 8.03E-06 9.13E-10 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 1.62E-06 NA mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 7.84E-10 3.57E-17 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 9.38E-07 NA mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 7.37E-14 7.13E-19 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 NA 2.52E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 NA 1.85E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 1.18E-06 NA mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 1.04E-12 2.31E-14 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 9.04E-06 9.71E-12 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674740 1.07E-06 6.43E-13 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251