\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610674623:

Variant ID: vg0610674623 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10674623
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.28, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTGAATGAAAATGTGAAATTGGATGAGCCGGCTAGCAGCCTGGTGCTCGGAGGAGACGAGACGTCGAAACTCGAGATGAATTGAATAAGTTACAGATA[T/C]
GAAAACGAAAGAGAATACAAAACGCCGTGGGGCCTCGGGGCTTGGGGTTGAGAATACGAAGCGCCACGCACGCGAAGTCGCCGCGCGGAGATACGCGCGG

Reverse complement sequence

CCGCGCGTATCTCCGCGCGGCGACTTCGCGTGCGTGGCGCTTCGTATTCTCAACCCCAAGCCCCGAGGCCCCACGGCGTTTTGTATTCTCTTTCGTTTTC[A/G]
TATCTGTAACTTATTCAATTCATCTCGAGTTTCGACGTCTCGTCTCCTCCGAGCACCAGGCTGCTAGCCGGCTCATCCAATTTCACATTTTCATTCAACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.10% 14.90% 0.02% 0.00% NA
All Indica  2759 88.00% 12.00% 0.04% 0.00% NA
All Japonica  1512 76.50% 23.50% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 95.80% 4.20% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 77.00% 23.00% 0.00% 0.00% NA
Indica Intermediate  786 88.50% 11.30% 0.13% 0.00% NA
Temperate Japonica  767 58.10% 41.90% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 85.90% 14.10% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610674623 T -> C LOC_Os06g18800.1 upstream_gene_variant ; 2138.0bp to feature; MODIFIER silent_mutation Average:63.697; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0610674623 T -> C LOC_Os06g18800-LOC_Os06g18810 intergenic_region ; MODIFIER silent_mutation Average:63.697; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610674623 1.12E-06 NA mr1065 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 3.19E-21 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 2.13E-07 9.62E-11 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 1.53E-07 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 1.82E-07 NA mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 2.69E-06 NA mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 5.20E-09 NA mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 NA 2.82E-06 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 7.32E-07 NA mr1108 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 8.12E-08 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 6.47E-06 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 1.34E-07 NA mr1234 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 4.30E-06 NA mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 2.56E-23 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 1.86E-08 1.97E-14 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 4.14E-07 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 8.88E-11 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 NA 3.03E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 2.91E-07 NA mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 1.03E-07 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 3.29E-06 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 2.46E-06 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 1.25E-06 NA mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 9.09E-08 NA mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 8.43E-06 NA mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610674623 7.03E-06 NA mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251