Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0610645391:

Variant ID: vg0610645391 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10645391
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

TAAGATATAAATCACACTTAAAGTACTATAAGTGATAAAACAACTCATAACAAAATAAATTATAATTACGTAAATTTTTTGAATAAGACGAATGGTCAAA[C/T]
ATGTGAGAAAAAATTAACGGCGTCATCTATTAAAAAACGGAGGTAGTATGATTCAATTTTAACTTATCGCACATCAATCTTATTACTGTAATTTTACATT

Reverse complement sequence

AATGTAAAATTACAGTAATAAGATTGATGTGCGATAAGTTAAAATTGAATCATACTACCTCCGTTTTTTAATAGATGACGCCGTTAATTTTTTCTCACAT[G/A]
TTTGACCATTCGTCTTATTCAAAAAATTTACGTAATTATAATTTATTTTGTTATGAGTTGTTTTATCACTTATAGTACTTTAAGTGTGATTTATATCTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.40%	13.60%	0.28%	7.74%	NA
All Indica	2759	72.90%	17.30%	0.11%	9.71%	NA
All Japonica	1512	87.40%	6.70%	0.66%	5.22%	NA
Aus	269	82.20%	15.60%	0.00%	2.23%	NA
Indica I	595	88.10%	11.80%	0.17%	0.00%	NA
Indica II	465	75.90%	16.10%	0.00%	7.96%	NA
Indica III	913	57.40%	22.30%	0.22%	20.04%	NA
Indica Intermediate	786	77.50%	16.40%	0.00%	6.11%	NA
Temperate Japonica	767	90.50%	0.70%	0.00%	8.87%	NA
Tropical Japonica	504	79.80%	17.90%	1.98%	0.40%	NA
Japonica Intermediate	241	93.40%	2.90%	0.00%	3.73%	NA
VI/Aromatic	96	87.50%	3.10%	0.00%	9.38%	NA
Intermediate	90	76.70%	18.90%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610645391	C -> T	LOC_Os06g18770.1	upstream_gene_variant ; 3130.0bp to feature; MODIFIER	silent_mutation	Average:52.07; most accessible tissue: Minghui63 root, score: 71.259	N	N	N	N
vg0610645391	C -> T	LOC_Os06g18780.1	upstream_gene_variant ; 4149.0bp to feature; MODIFIER	silent_mutation	Average:52.07; most accessible tissue: Minghui63 root, score: 71.259	N	N	N	N
vg0610645391	C -> T	LOC_Os06g18770-LOC_Os06g18780	intergenic_region ; MODIFIER	silent_mutation	Average:52.07; most accessible tissue: Minghui63 root, score: 71.259	N	N	N	N
vg0610645391	C -> DEL	N	N	silent_mutation	Average:52.07; most accessible tissue: Minghui63 root, score: 71.259	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610645391	1.55E-07	NA	mr1068	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391	6.24E-09	NA	mr1090	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391	NA	1.39E-08	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391	NA	1.95E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391	8.32E-11	NA	mr1211	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391	NA	1.18E-10	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391	4.12E-06	NA	mr1068_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391	2.47E-07	NA	mr1090_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391	NA	5.06E-07	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391	2.32E-08	NA	mr1211_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391	NA	2.00E-08	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251