\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610645391:

Variant ID: vg0610645391 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10645391
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGATATAAATCACACTTAAAGTACTATAAGTGATAAAACAACTCATAACAAAATAAATTATAATTACGTAAATTTTTTGAATAAGACGAATGGTCAAA[C/T]
ATGTGAGAAAAAATTAACGGCGTCATCTATTAAAAAACGGAGGTAGTATGATTCAATTTTAACTTATCGCACATCAATCTTATTACTGTAATTTTACATT

Reverse complement sequence

AATGTAAAATTACAGTAATAAGATTGATGTGCGATAAGTTAAAATTGAATCATACTACCTCCGTTTTTTAATAGATGACGCCGTTAATTTTTTCTCACAT[G/A]
TTTGACCATTCGTCTTATTCAAAAAATTTACGTAATTATAATTTATTTTGTTATGAGTTGTTTTATCACTTATAGTACTTTAAGTGTGATTTATATCTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.40% 13.60% 0.28% 7.74% NA
All Indica  2759 72.90% 17.30% 0.11% 9.71% NA
All Japonica  1512 87.40% 6.70% 0.66% 5.22% NA
Aus  269 82.20% 15.60% 0.00% 2.23% NA
Indica I  595 88.10% 11.80% 0.17% 0.00% NA
Indica II  465 75.90% 16.10% 0.00% 7.96% NA
Indica III  913 57.40% 22.30% 0.22% 20.04% NA
Indica Intermediate  786 77.50% 16.40% 0.00% 6.11% NA
Temperate Japonica  767 90.50% 0.70% 0.00% 8.87% NA
Tropical Japonica  504 79.80% 17.90% 1.98% 0.40% NA
Japonica Intermediate  241 93.40% 2.90% 0.00% 3.73% NA
VI/Aromatic  96 87.50% 3.10% 0.00% 9.38% NA
Intermediate  90 76.70% 18.90% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610645391 C -> T LOC_Os06g18770.1 upstream_gene_variant ; 3130.0bp to feature; MODIFIER silent_mutation Average:52.07; most accessible tissue: Minghui63 root, score: 71.259 N N N N
vg0610645391 C -> T LOC_Os06g18780.1 upstream_gene_variant ; 4149.0bp to feature; MODIFIER silent_mutation Average:52.07; most accessible tissue: Minghui63 root, score: 71.259 N N N N
vg0610645391 C -> T LOC_Os06g18770-LOC_Os06g18780 intergenic_region ; MODIFIER silent_mutation Average:52.07; most accessible tissue: Minghui63 root, score: 71.259 N N N N
vg0610645391 C -> DEL N N silent_mutation Average:52.07; most accessible tissue: Minghui63 root, score: 71.259 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610645391 1.55E-07 NA mr1068 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391 6.24E-09 NA mr1090 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391 NA 1.39E-08 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391 NA 1.95E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391 8.32E-11 NA mr1211 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391 NA 1.18E-10 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391 4.12E-06 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391 2.47E-07 NA mr1090_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391 NA 5.06E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391 2.32E-08 NA mr1211_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610645391 NA 2.00E-08 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251