\
| Variant ID: vg0610643802 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10643802 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 99. )
ACATATGCGGGGACGGTCCGATGCACTTCCGCAGCCCATTGGGCGCAGCGTAATCAACGGCGGCGACAGCCCGACGCTAGGCGAATCTGAGCCGTCCGAT[C/G]
TAATGGACGGCTCCAATCGTACCCGCGCTGGATGAAGCGCCGATCGGGGAGAGGGGCAAAACCCTGGCTCCCAAATCCCTCTCTCCTGATACCATTTATC
GATAAATGGTATCAGGAGAGAGGGATTTGGGAGCCAGGGTTTTGCCCCTCTCCCCGATCGGCGCTTCATCCAGCGCGGGTACGATTGGAGCCGTCCATTA[G/C]
ATCGGACGGCTCAGATTCGCCTAGCGTCGGGCTGTCGCCGCCGTTGATTACGCTGCGCCCAATGGGCTGCGGAAGTGCATCGGACCGTCCCCGCATATGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.00% | 3.10% | 10.35% | 14.49% | NA |
| All Indica | 2759 | 56.10% | 5.10% | 16.89% | 21.86% | NA |
| All Japonica | 1512 | 95.30% | 0.10% | 0.73% | 3.84% | NA |
| Aus | 269 | 98.10% | 0.00% | 0.00% | 1.86% | NA |
| Indica I | 595 | 29.10% | 9.10% | 30.42% | 31.43% | NA |
| Indica II | 465 | 24.70% | 8.20% | 30.75% | 36.34% | NA |
| Indica III | 913 | 82.60% | 1.80% | 3.29% | 12.38% | NA |
| Indica Intermediate | 786 | 64.40% | 4.30% | 14.25% | 17.05% | NA |
| Temperate Japonica | 767 | 92.40% | 0.10% | 1.30% | 6.13% | NA |
| Tropical Japonica | 504 | 99.20% | 0.20% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.00% | 0.00% | 3.73% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 68.90% | 3.30% | 13.33% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610643802 | C -> G | LOC_Os06g18770.1 | upstream_gene_variant ; 1541.0bp to feature; MODIFIER | silent_mutation | Average:59.802; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 | N | N | N | N |
| vg0610643802 | C -> G | LOC_Os06g18770-LOC_Os06g18780 | intergenic_region ; MODIFIER | silent_mutation | Average:59.802; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 | N | N | N | N |
| vg0610643802 | C -> DEL | N | N | silent_mutation | Average:59.802; most accessible tissue: Zhenshan97 flag leaf, score: 75.143 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610643802 | 2.57E-22 | 8.89E-86 | mr1065 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 4.03E-19 | 2.43E-36 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 4.76E-17 | 2.13E-73 | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 3.28E-14 | 1.83E-31 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 9.42E-07 | NA | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 6.12E-06 | 7.93E-10 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 7.89E-08 | NA | mr1078 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 9.43E-08 | 9.56E-13 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.67E-15 | 2.93E-58 | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 3.56E-15 | 2.02E-23 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 6.54E-29 | 3.46E-91 | mr1091 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 6.72E-23 | 2.38E-44 | mr1091 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.84E-08 | 5.64E-40 | mr1094 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 9.81E-06 | 6.43E-10 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.03E-10 | 3.48E-51 | mr1096 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.90E-08 | 1.05E-12 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 2.48E-19 | 1.10E-76 | mr1108 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 7.55E-16 | 1.33E-32 | mr1108 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 8.62E-17 | 1.62E-62 | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 2.08E-12 | 3.96E-24 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 1.73E-07 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 3.10E-19 | 3.91E-73 | mr1112 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 8.90E-16 | 1.51E-30 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 2.99E-06 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 8.77E-08 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 2.69E-09 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 4.30E-07 | NA | mr1200 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 2.16E-06 | 6.40E-08 | mr1200 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 1.70E-09 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 3.74E-07 | 1.92E-10 | mr1215 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 5.23E-12 | 7.30E-29 | mr1218 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 6.31E-13 | 4.45E-21 | mr1218 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 1.04E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 5.30E-06 | mr1220 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.71E-14 | 1.32E-47 | mr1221 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 3.07E-14 | 2.52E-23 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 2.76E-20 | 2.08E-82 | mr1234 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 4.85E-14 | 1.63E-31 | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 2.34E-07 | 1.78E-39 | mr1237 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 3.14E-12 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 7.60E-06 | 1.16E-11 | mr1242 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 7.79E-23 | mr1244 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 3.79E-08 | mr1244 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 1.79E-10 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.44E-07 | 2.19E-27 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 9.33E-09 | 1.17E-15 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 5.00E-12 | 5.76E-51 | mr1526 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 4.87E-10 | 2.16E-16 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.63E-11 | 2.67E-33 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.50E-13 | 6.65E-25 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 6.85E-14 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 1.78E-09 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 2.90E-17 | 2.60E-48 | mr1877 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 4.11E-13 | 9.98E-19 | mr1877 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 3.13E-08 | mr1929 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 9.64E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 2.90E-29 | 2.17E-104 | mr1065_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.36E-29 | 2.51E-49 | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.81E-21 | 1.23E-82 | mr1067_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.12E-19 | 8.60E-35 | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 2.72E-09 | NA | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 2.62E-09 | 1.62E-12 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.88E-12 | NA | mr1078_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 3.83E-14 | 2.53E-18 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.11E-18 | NA | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 3.92E-21 | 5.14E-28 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 2.60E-30 | 5.35E-100 | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 2.42E-26 | 1.36E-47 | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 4.02E-08 | NA | mr1094_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 2.06E-06 | 1.70E-09 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.41E-10 | NA | mr1096_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 2.35E-10 | 2.15E-13 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 6.98E-23 | 1.75E-90 | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.14E-21 | 5.78E-38 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 5.73E-22 | 5.22E-70 | mr1110_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.88E-18 | 9.45E-28 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 5.52E-07 | NA | mr1111_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 5.27E-07 | 1.06E-09 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 2.27E-26 | 1.20E-94 | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 2.12E-24 | 1.66E-40 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 9.93E-07 | NA | mr1121_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 2.22E-07 | 4.50E-07 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 3.05E-06 | NA | mr1124_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 3.42E-06 | 1.90E-10 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 8.60E-07 | NA | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 4.84E-07 | 3.80E-10 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 3.74E-07 | mr1197_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.32E-07 | NA | mr1200_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 2.61E-08 | 1.83E-10 | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 2.14E-13 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 1.04E-09 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 4.49E-14 | 2.43E-44 | mr1218_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.43E-13 | 4.12E-29 | mr1218_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 1.35E-11 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 4.01E-07 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 2.60E-21 | 1.54E-73 | mr1221_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 6.26E-18 | 2.57E-37 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 4.77E-28 | 2.10E-104 | mr1234_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.05E-23 | 6.24E-43 | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 1.04E-14 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 1.87E-25 | mr1244_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 1.82E-08 | mr1244_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 5.08E-09 | 1.57E-34 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.78E-08 | 4.28E-16 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | NA | 1.37E-06 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 3.91E-16 | 5.35E-63 | mr1526_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 1.79E-17 | 5.59E-26 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 8.22E-13 | 2.21E-31 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 7.00E-12 | 2.74E-25 | mr1583_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 6.50E-10 | 3.55E-28 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 5.55E-12 | 1.22E-27 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 5.01E-13 | 1.41E-42 | mr1877_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610643802 | 2.60E-09 | 2.22E-16 | mr1877_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |