\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610642256:

Variant ID: vg0610642256 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10642256
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACCAGGCCCCCCTACCTGGCGCGCCACTGTCGACGGGGGATACCCGTAGACCGGATATAGAGGGTATTGGGGTACGCTGGTATAAGGATCTACGTAGTA[T/C]
GACATCGAGCAATTAAAAGACAAGAATTATACTGGTTCAGGCCCCTTGATAGGTAATAGCCCTAATCCAGTTGATATGGGATTATATGGTGGAAAACACA

Reverse complement sequence

TGTGTTTTCCACCATATAATCCCATATCAACTGGATTAGGGCTATTACCTATCAAGGGGCCTGAACCAGTATAATTCTTGTCTTTTAATTGCTCGATGTC[A/G]
TACTACGTAGATCCTTATACCAGCGTACCCCAATACCCTCTATATCCGGTCTACGGGTATCCCCCGTCGACAGTGGCGCGCCAGGTAGGGGGGCCTGGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.10% 11.60% 12.51% 42.72% NA
All Indica  2759 13.70% 5.60% 19.64% 61.07% NA
All Japonica  1512 57.50% 24.70% 1.52% 16.27% NA
Aus  269 81.40% 1.90% 4.09% 12.64% NA
Indica I  595 9.90% 6.70% 7.73% 75.63% NA
Indica II  465 2.60% 2.40% 11.83% 83.23% NA
Indica III  913 19.80% 4.90% 29.35% 45.89% NA
Indica Intermediate  786 16.00% 7.40% 22.01% 54.58% NA
Temperate Japonica  767 44.10% 43.40% 0.78% 11.73% NA
Tropical Japonica  504 69.80% 0.80% 2.78% 26.59% NA
Japonica Intermediate  241 74.70% 14.90% 1.24% 9.13% NA
VI/Aromatic  96 78.10% 9.40% 2.08% 10.42% NA
Intermediate  90 26.70% 10.00% 14.44% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610642256 T -> C LOC_Os06g18770.1 synonymous_variant ; p.Ser2Ser; LOW synonymous_codon Average:32.767; most accessible tissue: Minghui63 root, score: 49.234 N N N N
vg0610642256 T -> DEL LOC_Os06g18770.1 N frameshift_variant Average:32.767; most accessible tissue: Minghui63 root, score: 49.234 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610642256 3.16E-09 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 1.16E-06 1.10E-08 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 1.61E-06 NA mr1078 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 7.52E-07 8.09E-10 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 2.07E-10 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 1.68E-07 1.86E-09 mr1090 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 3.63E-06 NA mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 NA 1.17E-06 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 NA 1.43E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 3.85E-09 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 NA 3.15E-06 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 3.25E-07 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 NA 5.95E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 9.84E-08 NA mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 6.17E-08 3.41E-13 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 1.01E-09 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 2.63E-07 8.99E-12 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 NA 1.10E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 5.82E-06 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 NA 1.46E-06 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 NA 1.25E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 5.19E-07 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 NA 7.78E-09 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610642256 NA 6.33E-09 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251