Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610641076:

Variant ID: vg0610641076 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10641076
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.74, G: 0.27, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TGTCTCGACGCCGATCTTCTTCATCTTCGTCATTACGGCGACGGCCATGACCAATGCTGTCCGGCCCCCGCCGGTCGCGATCGTCGTAGTCTCGGTCCTC[G/A]
TTTGGACGACTTCTTCGATCATGGTGTCGTGAGGAGACATGACGCCGGGAGTGGTTCACGTCATCCCGTGCTCGCCGTGCTTCTCGACGACCATTGATTT

Reverse complement sequence

AAATCAATGGTCGTCGAGAAGCACGGCGAGCACGGGATGACGTGAACCACTCCCGGCGTCATGTCTCCTCACGACACCATGATCGAAGAAGTCGTCCAAA[C/T]
GAGGACCGAGACTACGACGATCGCGACCGGCGGGGGCCGGACAGCATTGGTCATGGCCGTCGCCGTAATGACGAAGATGAAGAAGATCGGCGTCGAGACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.70%	17.80%	1.27%	53.24%	NA
All Indica	2759	4.20%	16.30%	1.88%	77.56%	NA
All Japonica	1512	57.70%	24.60%	0.13%	17.59%	NA
Aus	269	81.80%	0.70%	0.74%	16.73%	NA
Indica I	595	6.70%	10.80%	1.01%	81.51%	NA
Indica II	465	1.50%	3.90%	1.94%	92.69%	NA
Indica III	913	2.10%	22.90%	1.97%	73.06%	NA
Indica Intermediate	786	6.40%	20.40%	2.42%	70.87%	NA
Temperate Japonica	767	44.30%	43.30%	0.13%	12.26%	NA
Tropical Japonica	504	69.80%	0.80%	0.20%	29.17%	NA
Japonica Intermediate	241	74.70%	14.90%	0.00%	10.37%	NA
VI/Aromatic	96	83.30%	3.10%	4.17%	9.38%	NA
Intermediate	90	24.40%	13.30%	0.00%	62.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610641076	G -> A	LOC_Os06g18770.1	downstream_gene_variant ; 247.0bp to feature; MODIFIER	silent_mutation	Average:7.157; most accessible tissue: Callus, score: 31.083	N	N	N	N
vg0610641076	G -> A	LOC_Os06g18750-LOC_Os06g18770	intergenic_region ; MODIFIER	silent_mutation	Average:7.157; most accessible tissue: Callus, score: 31.083	N	N	N	N
vg0610641076	G -> DEL	N	N	silent_mutation	Average:7.157; most accessible tissue: Callus, score: 31.083	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610641076	7.87E-06	NA	mr1078	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610641076	4.32E-07	NA	mr1211	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610641076	2.76E-06	NA	mr1078_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610641076	1.53E-07	NA	mr1124_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610641076	3.16E-06	NA	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610641076	5.52E-06	NA	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251