\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610640917:

Variant ID: vg0610640917 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10640917
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.35, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCGGGTTGTCGGCGGTCGCGTGACCTTCGTGGATCTTGGTCTGACGATGAAGAGGACTCGGATGATGATGATGATGACGATGGGTCGCTTGGTTCCGG[C/T]
GTACGATTACGAGGGTGACGACCTGGATCTCGGGAATCTTGTCTTCGTCTCTCGCTGTTGTCTCGACGCCGATCTTCTTCATCTTCGTCATTACGGCGAC

Reverse complement sequence

GTCGCCGTAATGACGAAGATGAAGAAGATCGGCGTCGAGACAACAGCGAGAGACGAAGACAAGATTCCCGAGATCCAGGTCGTCACCCTCGTAATCGTAC[G/A]
CCGGAACCAAGCGACCCATCGTCATCATCATCATCATCCGAGTCCTCTTCATCGTCAGACCAAGATCCACGAAGGTCACGCGACCGCCGACAACCCGCCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.40% 27.30% 9.18% 36.10% NA
All Indica  2759 4.00% 31.30% 14.43% 50.34% NA
All Japonica  1512 57.50% 24.90% 0.60% 17.06% NA
Aus  269 81.00% 7.10% 4.46% 7.43% NA
Indica I  595 6.60% 22.90% 15.46% 55.13% NA
Indica II  465 1.10% 25.20% 20.43% 53.33% NA
Indica III  913 2.00% 35.50% 12.38% 50.16% NA
Indica Intermediate  786 6.00% 36.40% 12.47% 45.17% NA
Temperate Japonica  767 44.10% 43.40% 0.26% 12.26% NA
Tropical Japonica  504 69.60% 1.40% 1.19% 27.78% NA
Japonica Intermediate  241 74.70% 14.90% 0.41% 9.96% NA
VI/Aromatic  96 83.30% 9.40% 2.08% 5.21% NA
Intermediate  90 22.20% 25.60% 14.44% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610640917 C -> T LOC_Os06g18770.1 downstream_gene_variant ; 406.0bp to feature; MODIFIER silent_mutation Average:5.943; most accessible tissue: Callus, score: 20.699 N N N N
vg0610640917 C -> T LOC_Os06g18750-LOC_Os06g18770 intergenic_region ; MODIFIER silent_mutation Average:5.943; most accessible tissue: Callus, score: 20.699 N N N N
vg0610640917 C -> DEL N N silent_mutation Average:5.943; most accessible tissue: Callus, score: 20.699 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610640917 3.94E-06 NA mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640917 9.31E-06 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640917 3.72E-06 NA mr1101 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640917 1.91E-07 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640917 1.44E-06 NA mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640917 1.09E-07 NA mr1099_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640917 2.57E-06 NA mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640917 2.96E-07 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640917 NA 7.58E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640917 8.37E-06 NA mr1929_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251