Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610640917:

Variant ID: vg0610640917 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10640917
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.35, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

CGGCGGGTTGTCGGCGGTCGCGTGACCTTCGTGGATCTTGGTCTGACGATGAAGAGGACTCGGATGATGATGATGATGACGATGGGTCGCTTGGTTCCGG[C/T]
GTACGATTACGAGGGTGACGACCTGGATCTCGGGAATCTTGTCTTCGTCTCTCGCTGTTGTCTCGACGCCGATCTTCTTCATCTTCGTCATTACGGCGAC

Reverse complement sequence

GTCGCCGTAATGACGAAGATGAAGAAGATCGGCGTCGAGACAACAGCGAGAGACGAAGACAAGATTCCCGAGATCCAGGTCGTCACCCTCGTAATCGTAC[G/A]
CCGGAACCAAGCGACCCATCGTCATCATCATCATCATCCGAGTCCTCTTCATCGTCAGACCAAGATCCACGAAGGTCACGCGACCGCCGACAACCCGCCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.40%	27.30%	9.18%	36.10%	NA
All Indica	2759	4.00%	31.30%	14.43%	50.34%	NA
All Japonica	1512	57.50%	24.90%	0.60%	17.06%	NA
Aus	269	81.00%	7.10%	4.46%	7.43%	NA
Indica I	595	6.60%	22.90%	15.46%	55.13%	NA
Indica II	465	1.10%	25.20%	20.43%	53.33%	NA
Indica III	913	2.00%	35.50%	12.38%	50.16%	NA
Indica Intermediate	786	6.00%	36.40%	12.47%	45.17%	NA
Temperate Japonica	767	44.10%	43.40%	0.26%	12.26%	NA
Tropical Japonica	504	69.60%	1.40%	1.19%	27.78%	NA
Japonica Intermediate	241	74.70%	14.90%	0.41%	9.96%	NA
VI/Aromatic	96	83.30%	9.40%	2.08%	5.21%	NA
Intermediate	90	22.20%	25.60%	14.44%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610640917	C -> T	LOC_Os06g18770.1	downstream_gene_variant ; 406.0bp to feature; MODIFIER	silent_mutation	Average:5.943; most accessible tissue: Callus, score: 20.699	N	N	N	N
vg0610640917	C -> T	LOC_Os06g18750-LOC_Os06g18770	intergenic_region ; MODIFIER	silent_mutation	Average:5.943; most accessible tissue: Callus, score: 20.699	N	N	N	N
vg0610640917	C -> DEL	N	N	silent_mutation	Average:5.943; most accessible tissue: Callus, score: 20.699	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610640917	3.94E-06	NA	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640917	9.31E-06	NA	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640917	3.72E-06	NA	mr1101	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640917	1.91E-07	NA	mr1211	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640917	1.44E-06	NA	mr1078_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640917	1.09E-07	NA	mr1099_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640917	2.57E-06	NA	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640917	2.96E-07	NA	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640917	NA	7.58E-08	mr1526_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640917	8.37E-06	NA	mr1929_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251