\
| Variant ID: vg0610640917 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10640917 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.35, others allele: 0.00, population size: 86. )
CGGCGGGTTGTCGGCGGTCGCGTGACCTTCGTGGATCTTGGTCTGACGATGAAGAGGACTCGGATGATGATGATGATGACGATGGGTCGCTTGGTTCCGG[C/T]
GTACGATTACGAGGGTGACGACCTGGATCTCGGGAATCTTGTCTTCGTCTCTCGCTGTTGTCTCGACGCCGATCTTCTTCATCTTCGTCATTACGGCGAC
GTCGCCGTAATGACGAAGATGAAGAAGATCGGCGTCGAGACAACAGCGAGAGACGAAGACAAGATTCCCGAGATCCAGGTCGTCACCCTCGTAATCGTAC[G/A]
CCGGAACCAAGCGACCCATCGTCATCATCATCATCATCCGAGTCCTCTTCATCGTCAGACCAAGATCCACGAAGGTCACGCGACCGCCGACAACCCGCCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.40% | 27.30% | 9.18% | 36.10% | NA |
| All Indica | 2759 | 4.00% | 31.30% | 14.43% | 50.34% | NA |
| All Japonica | 1512 | 57.50% | 24.90% | 0.60% | 17.06% | NA |
| Aus | 269 | 81.00% | 7.10% | 4.46% | 7.43% | NA |
| Indica I | 595 | 6.60% | 22.90% | 15.46% | 55.13% | NA |
| Indica II | 465 | 1.10% | 25.20% | 20.43% | 53.33% | NA |
| Indica III | 913 | 2.00% | 35.50% | 12.38% | 50.16% | NA |
| Indica Intermediate | 786 | 6.00% | 36.40% | 12.47% | 45.17% | NA |
| Temperate Japonica | 767 | 44.10% | 43.40% | 0.26% | 12.26% | NA |
| Tropical Japonica | 504 | 69.60% | 1.40% | 1.19% | 27.78% | NA |
| Japonica Intermediate | 241 | 74.70% | 14.90% | 0.41% | 9.96% | NA |
| VI/Aromatic | 96 | 83.30% | 9.40% | 2.08% | 5.21% | NA |
| Intermediate | 90 | 22.20% | 25.60% | 14.44% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610640917 | C -> T | LOC_Os06g18770.1 | downstream_gene_variant ; 406.0bp to feature; MODIFIER | silent_mutation | Average:5.943; most accessible tissue: Callus, score: 20.699 | N | N | N | N |
| vg0610640917 | C -> T | LOC_Os06g18750-LOC_Os06g18770 | intergenic_region ; MODIFIER | silent_mutation | Average:5.943; most accessible tissue: Callus, score: 20.699 | N | N | N | N |
| vg0610640917 | C -> DEL | N | N | silent_mutation | Average:5.943; most accessible tissue: Callus, score: 20.699 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610640917 | 3.94E-06 | NA | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610640917 | 9.31E-06 | NA | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610640917 | 3.72E-06 | NA | mr1101 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610640917 | 1.91E-07 | NA | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610640917 | 1.44E-06 | NA | mr1078_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610640917 | 1.09E-07 | NA | mr1099_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610640917 | 2.57E-06 | NA | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610640917 | 2.96E-07 | NA | mr1211_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610640917 | NA | 7.58E-08 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610640917 | 8.37E-06 | NA | mr1929_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |