\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610640647:

Variant ID: vg0610640647 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10640647
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTAAAACCTTGATCAAATGTATGCAATGAAGATCCAGATCGTTGAACCTGTATCAATCTACTGATCCAGGTCTTGATACAGTCTAAACATGTCGGTTT[T/C]
CGAATCATTAGTTTTGGGACCCGACAATAAAGCACTGTCAAGTAGACTTGGAGGAATTCTTCTGGGTCGGTGCTCCCATCATACTTTTCAATAGCTCCGG

Reverse complement sequence

CCGGAGCTATTGAAAAGTATGATGGGAGCACCGACCCAGAAGAATTCCTCCAAGTCTACTTGACAGTGCTTTATTGTCGGGTCCCAAAACTAATGATTCG[A/G]
AAACCGACATGTTTAGACTGTATCAAGACCTGGATCAGTAGATTGATACAGGTTCAACGATCTGGATCTTCATTGCATACATTTGATCAAGGTTTTAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.50% 11.20% 1.25% 54.04% NA
All Indica  2759 13.70% 5.50% 1.88% 78.87% NA
All Japonica  1512 57.90% 24.30% 0.00% 17.86% NA
Aus  269 81.80% 0.70% 1.49% 15.99% NA
Indica I  595 9.90% 7.20% 1.01% 81.85% NA
Indica II  465 2.20% 2.20% 2.58% 93.12% NA
Indica III  913 19.80% 5.00% 0.88% 74.26% NA
Indica Intermediate  786 16.30% 6.90% 3.31% 73.54% NA
Temperate Japonica  767 44.30% 43.20% 0.00% 12.52% NA
Tropical Japonica  504 70.00% 0.40% 0.00% 29.56% NA
Japonica Intermediate  241 75.50% 14.10% 0.00% 10.37% NA
VI/Aromatic  96 86.50% 0.00% 3.12% 10.42% NA
Intermediate  90 30.00% 8.90% 0.00% 61.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610640647 T -> C LOC_Os06g18770.1 downstream_gene_variant ; 676.0bp to feature; MODIFIER silent_mutation Average:6.196; most accessible tissue: Callus, score: 17.339 N N N N
vg0610640647 T -> C LOC_Os06g18750-LOC_Os06g18770 intergenic_region ; MODIFIER silent_mutation Average:6.196; most accessible tissue: Callus, score: 17.339 N N N N
vg0610640647 T -> DEL N N silent_mutation Average:6.196; most accessible tissue: Callus, score: 17.339 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610640647 2.31E-06 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640647 1.66E-06 2.35E-09 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640647 1.37E-06 NA mr1241 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640647 5.00E-06 9.81E-11 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251