\
| Variant ID: vg0610636473 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10636473 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAGATCGTCTTCGATCGCATGACGCTTGTATGTTCCTTGGAAATTGGCGACGAACTGCTGCCACAGGTCTGACCACGAAGAAATTGAGTAGGGGGGAGAT[A/G]
CATCAGCCACGAACGTGCAGAACCCTTCAACGCGGTTGGTAAATAGTTTGCCAACGCATTGTCATCTGCTCCAGCGGCATAAATGTAACATCCTGAAAAT
ATTTTCAGGATGTTACATTTATGCCGCTGGAGCAGATGACAATGCGTTGGCAAACTATTTACCAACCGCGTTGAAGGGTTCTGCACGTTCGTGGCTGATG[T/C]
ATCTCCCCCCTACTCAATTTCTTCGTGGTCAGACCTGTGGCAGCAGTTCGTCGCCAATTTCCAAGGAACATACAAGCGTCATGCGATCGAAGACGATCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.60% | 10.90% | 15.83% | 33.64% | NA |
| All Indica | 2759 | 23.60% | 5.00% | 25.99% | 45.38% | NA |
| All Japonica | 1512 | 57.90% | 24.30% | 0.46% | 17.33% | NA |
| Aus | 269 | 83.60% | 0.70% | 4.09% | 11.52% | NA |
| Indica I | 595 | 17.00% | 6.70% | 27.39% | 48.91% | NA |
| Indica II | 465 | 12.70% | 1.70% | 31.40% | 54.19% | NA |
| Indica III | 913 | 30.70% | 4.20% | 23.55% | 41.62% | NA |
| Indica Intermediate | 786 | 27.00% | 6.60% | 24.55% | 41.86% | NA |
| Temperate Japonica | 767 | 44.30% | 43.20% | 0.52% | 11.99% | NA |
| Tropical Japonica | 504 | 70.00% | 0.60% | 0.60% | 28.77% | NA |
| Japonica Intermediate | 241 | 75.90% | 13.70% | 0.00% | 10.37% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 4.17% | 7.29% | NA |
| Intermediate | 90 | 37.80% | 10.00% | 10.00% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610636473 | A -> G | LOC_Os06g18770.1 | downstream_gene_variant ; 4850.0bp to feature; MODIFIER | silent_mutation | Average:15.48; most accessible tissue: Callus, score: 56.683 | N | N | N | N |
| vg0610636473 | A -> G | LOC_Os06g18750-LOC_Os06g18770 | intergenic_region ; MODIFIER | silent_mutation | Average:15.48; most accessible tissue: Callus, score: 56.683 | N | N | N | N |
| vg0610636473 | A -> DEL | N | N | silent_mutation | Average:15.48; most accessible tissue: Callus, score: 56.683 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610636473 | 6.75E-06 | NA | mr1027 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610636473 | 8.71E-12 | NA | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610636473 | 2.13E-07 | 9.62E-11 | mr1087 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610636473 | NA | 2.82E-06 | mr1096 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610636473 | 4.93E-08 | NA | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610636473 | 1.86E-08 | 1.97E-14 | mr1087_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610636473 | NA | 3.03E-06 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |