\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610636368:

Variant ID: vg0610636368 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10636368
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.77, G: 0.24, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GCGAATTACATAAGCGTCGGTGATCTCGGGGATGGTGTTCCTGCACTCGTTAAAGCGCCGAACGTATTCCCTCAAAGATTCCCCTGAGTTATGTGTTAAC[G/A]
CGTGAAGATCGTCTTCGATCGCATGACGCTTGTATGTTCCTTGGAAATTGGCGACGAACTGCTGCCACAGGTCTGACCACGAAGAAATTGAGTAGGGGGG

Reverse complement sequence

CCCCCCTACTCAATTTCTTCGTGGTCAGACCTGTGGCAGCAGTTCGTCGCCAATTTCCAAGGAACATACAAGCGTCATGCGATCGAAGACGATCTTCACG[C/T]
GTTAACACATAACTCAGGGGAATCTTTGAGGGAATACGTTCGGCGCTTTAACGAGTGCAGGAACACCATCCCCGAGATCACCGACGCTTATGTAATTCGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.60% 17.20% 0.87% 54.30% NA
All Indica  2759 4.10% 15.20% 1.34% 79.41% NA
All Japonica  1512 57.60% 24.80% 0.00% 17.59% NA
Aus  269 81.80% 0.70% 1.49% 15.99% NA
Indica I  595 6.60% 10.40% 0.50% 82.52% NA
Indica II  465 1.30% 3.20% 1.94% 93.55% NA
Indica III  913 2.00% 22.50% 0.99% 74.59% NA
Indica Intermediate  786 6.20% 17.40% 2.04% 74.30% NA
Temperate Japonica  767 44.10% 43.50% 0.00% 12.39% NA
Tropical Japonica  504 70.00% 1.00% 0.00% 28.97% NA
Japonica Intermediate  241 74.70% 14.90% 0.00% 10.37% NA
VI/Aromatic  96 83.30% 3.10% 0.00% 13.54% NA
Intermediate  90 25.60% 15.60% 0.00% 58.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610636368 G -> A LOC_Os06g18770.1 downstream_gene_variant ; 4955.0bp to feature; MODIFIER silent_mutation Average:11.824; most accessible tissue: Callus, score: 46.145 N N N N
vg0610636368 G -> A LOC_Os06g18750-LOC_Os06g18770 intergenic_region ; MODIFIER silent_mutation Average:11.824; most accessible tissue: Callus, score: 46.145 N N N N
vg0610636368 G -> DEL N N silent_mutation Average:11.824; most accessible tissue: Callus, score: 46.145 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610636368 3.67E-06 NA mr1065 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 NA 6.98E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 1.99E-15 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 8.48E-11 5.81E-15 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 NA 4.42E-08 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 6.57E-07 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 2.18E-07 1.02E-10 mr1090 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 8.87E-08 NA mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 7.52E-08 NA mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 6.26E-06 1.04E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 1.19E-07 NA mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 1.14E-06 1.64E-08 mr1096 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 3.10E-06 NA mr1110 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 NA 1.12E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 1.14E-06 3.02E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 NA 8.20E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 2.54E-06 5.03E-08 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 4.09E-07 NA mr1218 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 NA 4.36E-08 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 1.28E-06 NA mr1234 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 NA 3.80E-08 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 4.39E-12 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 NA 1.75E-09 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 6.69E-07 1.74E-12 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 NA 1.48E-10 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 5.87E-06 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 9.54E-06 NA mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 NA 6.47E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610636368 NA 4.31E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251