\
| Variant ID: vg0610634320 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10634320 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 268. )
GTGGGCGACTTCATGTTCTCGATTGCTTTGATCTTCTCGGGATTTGCCTCTATTCCTCTGCCAGAAACAAGGAATCCGAGTAGCTTGCCCGACGGTACTC[C/T]
GAACATGCACTTCTCTGGATTGAGCATGAGGCGATATCGTCGGAGGTTGTCGAACGTTTCCCGGAGGTCATCAATCAATGAGTCGCTTGTCTTGGTTTTG
CAAAACCAAGACAAGCGACTCATTGATTGATGACCTCCGGGAAACGTTCGACAACCTCCGACGATATCGCCTCATGCTCAATCCAGAGAAGTGCATGTTC[G/A]
GAGTACCGTCGGGCAAGCTACTCGGATTCCTTGTTTCTGGCAGAGGAATAGAGGCAAATCCCGAGAAGATCAAAGCAATCGAGAACATGAAGTCGCCCAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.40% | 2.00% | 1.86% | 9.78% | NA |
| All Indica | 2759 | 96.30% | 2.00% | 1.45% | 0.25% | NA |
| All Japonica | 1512 | 65.90% | 1.90% | 2.65% | 29.56% | NA |
| Aus | 269 | 94.10% | 3.00% | 2.23% | 0.74% | NA |
| Indica I | 595 | 98.70% | 0.50% | 0.34% | 0.50% | NA |
| Indica II | 465 | 98.50% | 0.90% | 0.43% | 0.22% | NA |
| Indica III | 913 | 93.00% | 4.20% | 2.85% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 1.40% | 1.27% | 0.38% | NA |
| Temperate Japonica | 767 | 55.10% | 0.70% | 1.56% | 42.63% | NA |
| Tropical Japonica | 504 | 81.70% | 4.60% | 2.58% | 11.11% | NA |
| Japonica Intermediate | 241 | 66.80% | 0.40% | 6.22% | 26.56% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 93.30% | 1.10% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610634320 | C -> T | LOC_Os06g18750.1 | downstream_gene_variant ; 3098.0bp to feature; MODIFIER | silent_mutation | Average:14.927; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0610634320 | C -> T | LOC_Os06g18750-LOC_Os06g18770 | intergenic_region ; MODIFIER | silent_mutation | Average:14.927; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0610634320 | C -> DEL | N | N | silent_mutation | Average:14.927; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610634320 | 9.87E-06 | 9.88E-06 | mr1205 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610634320 | 8.29E-06 | NA | mr1207 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610634320 | 8.98E-06 | NA | mr1214 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610634320 | 4.27E-06 | 4.27E-06 | mr1384 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610634320 | 1.69E-06 | 1.69E-06 | mr1663 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610634320 | 8.93E-06 | 8.93E-06 | mr1876 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |