\
| Variant ID: vg0610620315 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10620315 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 90. )
CAAGGATGCAGTCACTAGGACAATGCCAGCTATATCTCCCCCGAATCAAAGTGAGCAGCCCCGTTTGTGGTTTTCAGTTCGCTACTTATCATTGTGTAAT[A/C]
GAAAGTTTGTAGCAATCATGTAATAAATAAATATATTCATGATTATAAACAATGAGTTCGTTATGTTTATGGAAGATTCATGTTGAGGATGCAATGTACC
GGTACATTGCATCCTCAACATGAATCTTCCATAAACATAACGAACTCATTGTTTATAATCATGAATATATTTATTTATTACATGATTGCTACAAACTTTC[T/G]
ATTACACAATGATAAGTAGCGAACTGAAAACCACAAACGGGGCTGCTCACTTTGATTCGGGGGAGATATAGCTGGCATTGTCCTAGTGACTGCATCCTTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.80% | 2.90% | 3.20% | 23.09% | NA |
| All Indica | 2759 | 65.90% | 1.50% | 3.12% | 29.50% | NA |
| All Japonica | 1512 | 79.90% | 6.00% | 3.31% | 10.85% | NA |
| Aus | 269 | 59.10% | 0.40% | 3.72% | 36.80% | NA |
| Indica I | 595 | 41.80% | 0.00% | 2.18% | 55.97% | NA |
| Indica II | 465 | 54.00% | 7.10% | 3.01% | 35.91% | NA |
| Indica III | 913 | 88.70% | 0.00% | 2.63% | 8.65% | NA |
| Indica Intermediate | 786 | 64.60% | 1.00% | 4.45% | 29.90% | NA |
| Temperate Japonica | 767 | 79.00% | 0.10% | 1.83% | 19.04% | NA |
| Tropical Japonica | 504 | 77.40% | 15.70% | 5.95% | 0.99% | NA |
| Japonica Intermediate | 241 | 88.00% | 4.10% | 2.49% | 5.39% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 7.80% | 5.56% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610620315 | A -> C | LOC_Os06g18730.1 | downstream_gene_variant ; 140.0bp to feature; MODIFIER | silent_mutation | Average:29.321; most accessible tissue: Minghui63 young leaf, score: 48.378 | N | N | N | N |
| vg0610620315 | A -> C | LOC_Os06g18730-LOC_Os06g18740 | intergenic_region ; MODIFIER | silent_mutation | Average:29.321; most accessible tissue: Minghui63 young leaf, score: 48.378 | N | N | N | N |
| vg0610620315 | A -> DEL | N | N | silent_mutation | Average:29.321; most accessible tissue: Minghui63 young leaf, score: 48.378 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610620315 | 8.91E-11 | NA | mr1016 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 8.27E-08 | NA | mr1017 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 3.50E-10 | NA | mr1018 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 4.78E-06 | NA | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 2.48E-08 | NA | mr1022 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 2.90E-10 | NA | mr1023 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 3.21E-10 | NA | mr1055 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 3.95E-12 | NA | mr1079 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 3.32E-06 | NA | mr1079 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 9.02E-11 | NA | mr1132 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 2.07E-11 | NA | mr1142 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 8.52E-10 | NA | mr1178 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 1.19E-08 | NA | mr1390 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 1.34E-12 | NA | mr1489 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 1.56E-06 | NA | mr1489 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 1.25E-08 | NA | mr1490 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 1.91E-11 | NA | mr1491 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 4.92E-06 | NA | mr1491 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 4.66E-08 | NA | mr1778 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 4.66E-07 | NA | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 2.41E-10 | NA | mr1022_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 4.06E-06 | NA | mr1022_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 3.86E-11 | NA | mr1023_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 2.86E-06 | NA | mr1023_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 1.38E-10 | NA | mr1055_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 1.60E-06 | NA | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 3.36E-11 | NA | mr1079_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 5.58E-07 | NA | mr1079_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 1.89E-10 | NA | mr1132_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 8.71E-06 | NA | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 1.09E-11 | NA | mr1178_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 7.72E-06 | NA | mr1261_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 1.24E-09 | NA | mr1390_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 1.04E-06 | NA | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 1.15E-12 | NA | mr1489_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 1.33E-09 | NA | mr1490_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 1.32E-06 | NA | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | 2.08E-06 | NA | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610620315 | NA | 6.33E-06 | mr1892_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |