\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610611566:

Variant ID: vg0610611566 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10611566
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACTTGTCGATGACGTCTTCAAAATTGCTTCTCATCAAGGTCTTGTAATCTTCAATCGACAAGTCGTCTTGCTTAAAATACCGAAGAAAGCCAAGATTTA[T/C]
CTCAACTGGCAAAACGCCAATTTCAACAATGTTTTATTACTCGATTCGGCTTATCCATTAGCCCGAGCGTAGTAGAGGGAAGGACTCAACAACTTAATAT

Reverse complement sequence

ATATTAAGTTGTTGAGTCCTTCCCTCTACTACGCTCGGGCTAATGGATAAGCCGAATCGAGTAATAAAACATTGTTGAAATTGGCGTTTTGCCAGTTGAG[A/G]
TAAATCTTGGCTTTCTTCGGTATTTTAAGCAAGACGACTTGTCGATTGAAGATTACAAGACCTTGATGAGAAGCAATTTTGAAGACGTCATCGACAAGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.60% 0.10% 8.97% 45.26% NA
All Indica  2759 20.30% 0.20% 14.28% 65.20% NA
All Japonica  1512 82.50% 0.00% 0.79% 16.67% NA
Aus  269 82.90% 0.00% 2.97% 14.13% NA
Indica I  595 17.00% 0.00% 5.88% 77.14% NA
Indica II  465 6.90% 0.00% 9.25% 83.87% NA
Indica III  913 25.40% 0.70% 22.23% 51.70% NA
Indica Intermediate  786 24.80% 0.00% 14.38% 60.81% NA
Temperate Japonica  767 87.60% 0.00% 0.00% 12.39% NA
Tropical Japonica  504 71.40% 0.00% 2.18% 26.39% NA
Japonica Intermediate  241 89.60% 0.00% 0.41% 9.96% NA
VI/Aromatic  96 87.50% 0.00% 2.08% 10.42% NA
Intermediate  90 46.70% 0.00% 8.89% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610611566 T -> C LOC_Os06g18710.1 downstream_gene_variant ; 1157.0bp to feature; MODIFIER silent_mutation Average:9.52; most accessible tissue: Callus, score: 31.618 N N N N
vg0610611566 T -> C LOC_Os06g18720.1 downstream_gene_variant ; 1873.0bp to feature; MODIFIER silent_mutation Average:9.52; most accessible tissue: Callus, score: 31.618 N N N N
vg0610611566 T -> C LOC_Os06g18710-LOC_Os06g18720 intergenic_region ; MODIFIER silent_mutation Average:9.52; most accessible tissue: Callus, score: 31.618 N N N N
vg0610611566 T -> DEL N N silent_mutation Average:9.52; most accessible tissue: Callus, score: 31.618 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610611566 2.15E-11 5.24E-56 mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 1.49E-10 1.37E-10 mr1068 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 7.33E-06 NA mr1078 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 1.03E-11 7.42E-57 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 1.72E-09 4.83E-11 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 9.68E-13 3.69E-62 mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 3.70E-09 1.72E-11 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 9.57E-08 4.69E-38 mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 1.27E-06 1.80E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 6.17E-06 NA mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 4.60E-07 NA mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 1.68E-07 8.53E-08 mr1121 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 9.26E-06 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 NA 1.83E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 1.69E-09 1.66E-52 mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 9.49E-07 2.18E-09 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 4.29E-09 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 NA 1.45E-08 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 1.20E-07 NA mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 4.54E-06 6.74E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 6.72E-11 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 2.24E-06 1.72E-10 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 4.74E-13 4.27E-71 mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 8.31E-08 3.56E-13 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 2.91E-06 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 NA 2.74E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 1.38E-08 1.98E-49 mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 5.61E-06 8.88E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 NA 5.22E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 7.48E-07 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 9.50E-09 7.54E-58 mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 1.15E-06 5.74E-11 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 4.92E-11 NA mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611566 1.78E-07 2.30E-08 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251