RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0610611540:

Variant ID: vg0610611540 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10611540
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTTCATCTCCTTCAAAGTCTTCAAACACTTGTCGATGACGTCTTCAAAATTGCTTCTCATCAAGGTCTTGTAATCTTCAATCGACAAGTCGTCTTGCTT[A/G]
AAATACCGAAGAAAGCCAAGATTTATCTCAACTGGCAAAACGCCAATTTCAACAATGTTTTATTACTCGATTCGGCTTATCCATTAGCCCGAGCGTAGTA

Reverse complement sequence

TACTACGCTCGGGCTAATGGATAAGCCGAATCGAGTAATAAAACATTGTTGAAATTGGCGTTTTGCCAGTTGAGATAAATCTTGGCTTTCTTCGGTATTT[T/C]
AAGCAAGACGACTTGTCGATTGAAGATTACAAGACCTTGATGAGAAGCAATTTTGAAGACGTCATCGACAAGTGTTTGAAGACTTTGAAGGAGATGAAGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.10%	0.20%	11.07%	43.69%	NA
All Indica	2759	19.50%	0.30%	16.93%	63.36%	NA
All Japonica	1512	82.50%	0.00%	1.12%	16.40%	NA
Aus	269	82.90%	0.00%	8.55%	8.55%	NA
Indica I	595	16.10%	0.50%	4.71%	78.66%	NA
Indica II	465	4.70%	0.20%	11.83%	83.23%	NA
Indica III	913	25.40%	0.10%	25.63%	48.85%	NA
Indica Intermediate	786	23.80%	0.30%	19.08%	56.87%	NA
Temperate Japonica	767	87.60%	0.00%	0.52%	11.86%	NA
Tropical Japonica	504	71.20%	0.00%	2.18%	26.59%	NA
Japonica Intermediate	241	89.60%	0.00%	0.83%	9.54%	NA
VI/Aromatic	96	87.50%	0.00%	2.08%	10.42%	NA
Intermediate	90	43.30%	1.10%	15.56%	40.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610611540	A -> G	LOC_Os06g18710.1	downstream_gene_variant ; 1131.0bp to feature; MODIFIER	silent_mutation	Average:9.52; most accessible tissue: Callus, score: 31.618	N	N	N	N
vg0610611540	A -> G	LOC_Os06g18720.1	downstream_gene_variant ; 1899.0bp to feature; MODIFIER	silent_mutation	Average:9.52; most accessible tissue: Callus, score: 31.618	N	N	N	N
vg0610611540	A -> G	LOC_Os06g18710-LOC_Os06g18720	intergenic_region ; MODIFIER	silent_mutation	Average:9.52; most accessible tissue: Callus, score: 31.618	N	N	N	N
vg0610611540	A -> DEL	N	N	silent_mutation	Average:9.52; most accessible tissue: Callus, score: 31.618	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610611540	1.90E-08	1.20E-53	mr1065	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611540	3.98E-06	NA	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611540	1.25E-14	7.59E-65	mr1068	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611540	1.16E-07	2.36E-09	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611540	4.69E-07	4.68E-07	mr1068	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611540	2.13E-06	2.36E-49	mr1078	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611540	1.59E-16	3.22E-70	mr1087	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611540	1.27E-11	3.26E-15	mr1087	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611540	NA	4.07E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610611540	1.42E-18	6.91E-73	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 90 entries

Previous1 2 3 4 5…9Next

Search for Variation information by Variation ID:

Detailed information for vg0610611540:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact