\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610608770:

Variant ID: vg0610608770 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10608770
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.03, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTGTCCGAGGAGGTCTCTCTTCGTCCATTGACTTTACGAAGAGTTTCCTTAGACGCCAAAGGATTTATCCATGCACATGTGAATAGGCCTTGTCAATA[T/C]
GTGACGTATGTCGAGGGGTAGAGGGTATGCCTGACTCGTAACCCTGATAGTAGCCCCCGACTTTTGCTCAAAAATGAACTCGCGCGACTGTTTGCGATTT

Reverse complement sequence

AAATCGCAAACAGTCGCGCGAGTTCATTTTTGAGCAAAAGTCGGGGGCTACTATCAGGGTTACGAGTCAGGCATACCCTCTACCCCTCGACATACGTCAC[A/G]
TATTGACAAGGCCTATTCACATGTGCATGGATAAATCCTTTGGCGTCTAAGGAAACTCTTCGTAAAGTCAATGGACGAAGAGAGACCTCCTCGGACAAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.30% 27.50% 21.18% 23.04% NA
All Indica  2759 33.10% 4.10% 32.51% 30.30% NA
All Japonica  1512 24.90% 57.80% 2.51% 14.75% NA
Aus  269 4.80% 81.40% 13.01% 0.74% NA
Indica I  595 12.10% 6.20% 25.88% 55.80% NA
Indica II  465 16.10% 2.60% 27.10% 54.19% NA
Indica III  913 56.00% 1.60% 36.04% 6.35% NA
Indica Intermediate  786 32.40% 6.20% 36.64% 24.68% NA
Temperate Japonica  767 43.40% 44.30% 1.17% 11.08% NA
Tropical Japonica  504 2.00% 70.00% 4.56% 23.41% NA
Japonica Intermediate  241 14.10% 75.10% 2.49% 8.30% NA
VI/Aromatic  96 14.60% 77.10% 6.25% 2.08% NA
Intermediate  90 21.10% 22.20% 27.78% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610608770 T -> C LOC_Os06g18710.1 upstream_gene_variant ; 442.0bp to feature; MODIFIER silent_mutation Average:12.637; most accessible tissue: Callus, score: 27.759 N N N N
vg0610608770 T -> C LOC_Os06g18720.1 downstream_gene_variant ; 4669.0bp to feature; MODIFIER silent_mutation Average:12.637; most accessible tissue: Callus, score: 27.759 N N N N
vg0610608770 T -> C LOC_Os06g18690-LOC_Os06g18710 intergenic_region ; MODIFIER silent_mutation Average:12.637; most accessible tissue: Callus, score: 27.759 N N N N
vg0610608770 T -> DEL N N silent_mutation Average:12.637; most accessible tissue: Callus, score: 27.759 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610608770 8.49E-06 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 3.88E-07 NA mr1078 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 NA 1.41E-06 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 NA 3.33E-06 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 NA 2.01E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 6.75E-06 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 8.08E-06 4.53E-06 mr1858 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 8.31E-06 4.62E-06 mr1859 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 NA 4.93E-06 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 NA 9.09E-06 mr1911 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 4.56E-06 1.45E-06 mr1913 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 2.59E-06 NA mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 2.52E-07 4.16E-11 mr1067_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 5.57E-08 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 5.01E-06 7.40E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 4.02E-09 NA mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 4.90E-10 1.27E-10 mr1087_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 7.47E-10 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 2.95E-06 NA mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 NA 9.24E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 2.35E-06 NA mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 1.45E-06 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 1.05E-07 5.26E-08 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 5.25E-07 6.33E-09 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 NA 8.90E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 NA 5.48E-09 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 6.40E-11 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 7.87E-08 9.70E-09 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 1.17E-06 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 4.65E-06 NA mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 1.47E-07 8.40E-11 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 NA 3.06E-07 mr1911_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 NA 9.10E-07 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610608770 6.06E-06 3.87E-07 mr1929_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251