RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0610606146:

Variant ID: vg0610606146 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10606146
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.07, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

TAATAAAATGACTACGATAAGATTATGTCTACAGTTTAAATTTATTCTGCTACGAAGGACCTAGGAATATAATAAAGTAGCAGTGAAAATAAGATAAATA[C/A]
GTAGAAGCTCCATTCAACTTGCCACATGTAGTCAATTGTGACACACAACCTATTCCTCGTCTTCAGCAGCAAACTCTTCAGGAAACAATAAAAACATTTG

Reverse complement sequence

CAAATGTTTTTATTGTTTCCTGAAGAGTTTGCTGCTGAAGACGAGGAATAGGTTGTGTGTCACAATTGACTACATGTGGCAAGTTGAATGGAGCTTCTAC[G/T]
TATTTATCTTATTTTCACTGCTACTTTATTATATTCCTAGGTCCTTCGTAGCAGAATAAATTTAAACTGTAGACATAATCTTATCGTAGTCATTTTATTA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.70%	43.60%	1.90%	4.82%	NA
All Indica	2759	74.10%	17.00%	1.49%	7.43%	NA
All Japonica	1512	13.70%	82.70%	2.71%	0.93%	NA
Aus	269	16.40%	81.80%	1.49%	0.37%	NA
Indica I	595	88.60%	11.40%	0.00%	0.00%	NA
Indica II	465	89.90%	3.40%	2.58%	4.09%	NA
Indica III	913	56.10%	24.90%	1.86%	17.20%	NA
Indica Intermediate	786	74.70%	20.10%	1.53%	3.69%	NA
Temperate Japonica	767	5.00%	89.00%	4.43%	1.56%	NA
Tropical Japonica	504	30.00%	69.60%	0.20%	0.20%	NA
Japonica Intermediate	241	7.50%	89.60%	2.49%	0.41%	NA
VI/Aromatic	96	3.10%	88.50%	2.08%	6.25%	NA
Intermediate	90	56.70%	38.90%	2.22%	2.22%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610606146	C -> A	LOC_Os06g18710.1	upstream_gene_variant ; 3066.0bp to feature; MODIFIER	silent_mutation	Average:69.318; most accessible tissue: Minghui63 flag leaf, score: 85.151	N	N	N	N
vg0610606146	C -> A	LOC_Os06g18690-LOC_Os06g18710	intergenic_region ; MODIFIER	silent_mutation	Average:69.318; most accessible tissue: Minghui63 flag leaf, score: 85.151	N	N	N	N
vg0610606146	C -> DEL	N	N	silent_mutation	Average:69.318; most accessible tissue: Minghui63 flag leaf, score: 85.151	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610606146	2.05E-20	2.37E-82	mr1065	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610606146	2.97E-17	1.25E-25	mr1065	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610606146	1.61E-06	2.88E-53	mr1067	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610606146	8.00E-10	2.08E-17	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610606146	1.38E-33	8.92E-103	mr1068	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610606146	2.08E-26	2.08E-35	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610606146	3.49E-08	3.48E-08	mr1068	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610606146	7.86E-22	1.60E-80	mr1078	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610606146	1.75E-16	1.10E-22	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610606146	NA	4.31E-06	mr1078	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 132 entries

Previous1 2 3 4 5…14Next

Search for Variation information by Variation ID:

Detailed information for vg0610606146:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact