\
| Variant ID: vg0610592410 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10592410 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, G: 0.42, others allele: 0.00, population size: 85. )
AACAACACTCCTCTCAATTTTTGACTAAATTCAAATTCTAAGCTAAACCATAATTTTTCTTAAAATTATTCTCTTATAAAATCAATACCAAGAGGCCTCA[G/A,T]
CCCCTCTTCTATTTATATCATAAGATAGTATCCTAAAAACCACGAATTCTACTCAAATAAATACTCCTAATCCCATAGAAAACCTACGCATACAAGTATA
TATACTTGTATGCGTAGGTTTTCTATGGGATTAGGAGTATTTATTTGAGTAGAATTCGTGGTTTTTAGGATACTATCTTATGATATAAATAGAAGAGGGG[C/T,A]
TGAGGCCTCTTGGTATTGATTTTATAAGAGAATAATTTTAAGAAAAATTATGGTTTAGCTTAGAATTTGAATTTAGTCAAAAATTGAGAGGAGTGTTGTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.50% | 35.40% | 1.08% | 0.00% | T: 0.04% |
| All Indica | 2759 | 82.10% | 16.30% | 1.63% | 0.00% | NA |
| All Japonica | 1512 | 39.80% | 60.00% | 0.20% | 0.00% | NA |
| Aus | 269 | 19.00% | 81.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 68.10% | 27.10% | 4.82% | 0.00% | NA |
| Indica Intermediate | 786 | 81.90% | 18.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 49.40% | 50.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 31.70% | 68.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 26.10% | 73.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 85.40% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 18.90% | 1.11% | 0.00% | T: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610592410 | G -> T | LOC_Os06g18670.1 | upstream_gene_variant ; 2471.0bp to feature; MODIFIER | silent_mutation | Average:54.517; most accessible tissue: Zhenshan97 panicle, score: 86.788 | N | N | N | N |
| vg0610592410 | G -> T | LOC_Os06g18680.1 | upstream_gene_variant ; 2931.0bp to feature; MODIFIER | silent_mutation | Average:54.517; most accessible tissue: Zhenshan97 panicle, score: 86.788 | N | N | N | N |
| vg0610592410 | G -> T | LOC_Os06g18670-LOC_Os06g18680 | intergenic_region ; MODIFIER | silent_mutation | Average:54.517; most accessible tissue: Zhenshan97 panicle, score: 86.788 | N | N | N | N |
| vg0610592410 | G -> A | LOC_Os06g18670.1 | upstream_gene_variant ; 2471.0bp to feature; MODIFIER | silent_mutation | Average:54.517; most accessible tissue: Zhenshan97 panicle, score: 86.788 | N | N | N | N |
| vg0610592410 | G -> A | LOC_Os06g18680.1 | upstream_gene_variant ; 2931.0bp to feature; MODIFIER | silent_mutation | Average:54.517; most accessible tissue: Zhenshan97 panicle, score: 86.788 | N | N | N | N |
| vg0610592410 | G -> A | LOC_Os06g18670-LOC_Os06g18680 | intergenic_region ; MODIFIER | silent_mutation | Average:54.517; most accessible tissue: Zhenshan97 panicle, score: 86.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610592410 | 3.06E-08 | 1.74E-14 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | NA | 1.90E-11 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 4.36E-11 | NA | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 4.29E-12 | 1.87E-20 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 1.77E-08 | NA | mr1078 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | NA | 1.22E-08 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 2.36E-19 | 1.05E-29 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 3.48E-12 | NA | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 2.09E-16 | 2.20E-21 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 6.08E-09 | 1.10E-14 | mr1091 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 1.57E-07 | 5.55E-11 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 1.91E-06 | NA | mr1096 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 1.62E-10 | 1.78E-15 | mr1096 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 1.07E-08 | 2.15E-14 | mr1108 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | NA | 4.77E-12 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 1.45E-08 | 2.29E-11 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 8.11E-10 | 6.45E-16 | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 1.46E-06 | NA | mr1121 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 3.48E-10 | 1.56E-13 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 8.61E-06 | NA | mr1144 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 2.44E-09 | 5.70E-13 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 3.35E-07 | 8.74E-11 | mr1200 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 1.40E-10 | NA | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 3.34E-11 | 7.07E-14 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | NA | 1.47E-09 | mr1218 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 6.25E-06 | 4.34E-08 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 2.20E-06 | 4.38E-11 | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 6.10E-07 | 2.56E-11 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | NA | 2.41E-20 | mr1244 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 5.27E-07 | 7.65E-12 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 2.08E-07 | 5.00E-16 | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 5.58E-06 | 2.21E-13 | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 1.74E-11 | NA | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 3.53E-12 | 8.80E-22 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 3.32E-11 | NA | mr1078_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 3.71E-09 | 1.60E-16 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 5.63E-16 | 1.70E-31 | mr1087_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 2.24E-14 | NA | mr1090_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 3.11E-16 | 4.47E-24 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 5.91E-07 | 2.85E-14 | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 3.64E-07 | 7.25E-12 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 2.90E-07 | NA | mr1096_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 4.34E-09 | 5.13E-16 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 1.68E-08 | 1.02E-15 | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 8.39E-07 | 5.22E-13 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 2.17E-08 | NA | mr1111_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 2.24E-08 | 7.24E-14 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 4.24E-08 | 2.13E-15 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 2.02E-06 | NA | mr1121_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 4.02E-07 | 3.28E-12 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 5.95E-07 | NA | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 1.64E-06 | 7.59E-11 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 2.70E-06 | NA | mr1200_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 8.84E-08 | 8.99E-14 | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 3.05E-12 | NA | mr1211_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 3.52E-11 | 2.39E-15 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 1.62E-07 | 1.74E-10 | mr1218_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 7.59E-06 | 3.04E-09 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 4.04E-07 | 1.35E-14 | mr1234_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 5.38E-09 | NA | mr1526_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610592410 | 4.22E-12 | 1.61E-23 | mr1526_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |