Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610590324:

Variant ID: vg0610590324 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10590324
Reference Allele: T	Alternative Allele: G,C
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

CCAAAGAAAATTGGTTGGTCAAATGTTCTAGTTGACCAATGAGTGAAACATCAAATTATATATGGTGAAACAAAAAATCAGCAACTGAAACATTTAAAAA[T/G,C]
TTTATGAAACATGATAAAGATACACGTTGAAACATATCGCTATCACATATGAAACAACTAGTGTTAACGGATTAAAACATATGTTTTTCTTTCATCAAAA

Reverse complement sequence

TTTTGATGAAAGAAAAACATATGTTTTAATCCGTTAACACTAGTTGTTTCATATGTGATAGCGATATGTTTCAACGTGTATCTTTATCATGTTTCATAAA[A/C,G]
TTTTTAAATGTTTCAGTTGCTGATTTTTTGTTTCACCATATATAATTTGATGTTTCACTCATTGGTCAACTAGAACATTTGACCAACCAATTTTCTTTGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.40%	0.30%	3.60%	21.63%	C: 0.08%
All Indica	2759	59.10%	0.60%	5.84%	34.32%	C: 0.14%
All Japonica	1512	95.80%	0.00%	0.33%	3.84%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	41.70%	1.00%	13.61%	43.53%	C: 0.17%
Indica II	465	51.60%	0.60%	7.74%	40.00%	NA
Indica III	913	73.50%	0.40%	1.10%	24.86%	C: 0.11%
Indica Intermediate	786	60.10%	0.40%	4.33%	34.99%	C: 0.25%
Temperate Japonica	767	96.50%	0.00%	0.26%	3.26%	NA
Tropical Japonica	504	94.20%	0.00%	0.60%	5.16%	NA
Japonica Intermediate	241	97.10%	0.00%	0.00%	2.90%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	77.80%	0.00%	4.44%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610590324	T -> C	LOC_Os06g18670.1	upstream_gene_variant ; 385.0bp to feature; MODIFIER	silent_mutation	Average:14.961; most accessible tissue: Callus, score: 83.377	N	N	N	N
vg0610590324	T -> C	LOC_Os06g18670-LOC_Os06g18680	intergenic_region ; MODIFIER	silent_mutation	Average:14.961; most accessible tissue: Callus, score: 83.377	N	N	N	N
vg0610590324	T -> G	LOC_Os06g18670.1	upstream_gene_variant ; 385.0bp to feature; MODIFIER	silent_mutation	Average:14.961; most accessible tissue: Callus, score: 83.377	N	N	N	N
vg0610590324	T -> G	LOC_Os06g18670-LOC_Os06g18680	intergenic_region ; MODIFIER	silent_mutation	Average:14.961; most accessible tissue: Callus, score: 83.377	N	N	N	N
vg0610590324	T -> DEL	N	N	silent_mutation	Average:14.961; most accessible tissue: Callus, score: 83.377	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610590324	NA	5.60E-07	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324	1.76E-06	1.16E-20	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324	2.36E-06	1.70E-11	mr1583	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324	NA	2.25E-06	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324	9.21E-07	4.79E-19	mr1218_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324	1.53E-06	6.68E-08	mr1218_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324	2.14E-10	9.78E-38	mr1221_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324	2.63E-08	3.27E-13	mr1221_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324	2.45E-06	2.83E-07	mr1252_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324	NA	2.74E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324	1.63E-08	4.48E-25	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324	8.03E-08	1.73E-09	mr1422_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324	2.50E-07	1.41E-18	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324	9.46E-07	1.22E-10	mr1583_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324	3.54E-07	3.95E-17	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324	1.14E-06	1.55E-11	mr1850_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251