\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610590324:

Variant ID: vg0610590324 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10590324
Reference Allele: TAlternative Allele: G,C
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


CCAAAGAAAATTGGTTGGTCAAATGTTCTAGTTGACCAATGAGTGAAACATCAAATTATATATGGTGAAACAAAAAATCAGCAACTGAAACATTTAAAAA[T/G,C]
TTTATGAAACATGATAAAGATACACGTTGAAACATATCGCTATCACATATGAAACAACTAGTGTTAACGGATTAAAACATATGTTTTTCTTTCATCAAAA

Reverse complement sequence

TTTTGATGAAAGAAAAACATATGTTTTAATCCGTTAACACTAGTTGTTTCATATGTGATAGCGATATGTTTCAACGTGTATCTTTATCATGTTTCATAAA[A/C,G]
TTTTTAAATGTTTCAGTTGCTGATTTTTTGTTTCACCATATATAATTTGATGTTTCACTCATTGGTCAACTAGAACATTTGACCAACCAATTTTCTTTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.40% 0.30% 3.60% 21.63% C: 0.08%
All Indica  2759 59.10% 0.60% 5.84% 34.32% C: 0.14%
All Japonica  1512 95.80% 0.00% 0.33% 3.84% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 41.70% 1.00% 13.61% 43.53% C: 0.17%
Indica II  465 51.60% 0.60% 7.74% 40.00% NA
Indica III  913 73.50% 0.40% 1.10% 24.86% C: 0.11%
Indica Intermediate  786 60.10% 0.40% 4.33% 34.99% C: 0.25%
Temperate Japonica  767 96.50% 0.00% 0.26% 3.26% NA
Tropical Japonica  504 94.20% 0.00% 0.60% 5.16% NA
Japonica Intermediate  241 97.10% 0.00% 0.00% 2.90% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 77.80% 0.00% 4.44% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610590324 T -> C LOC_Os06g18670.1 upstream_gene_variant ; 385.0bp to feature; MODIFIER silent_mutation Average:14.961; most accessible tissue: Callus, score: 83.377 N N N N
vg0610590324 T -> C LOC_Os06g18670-LOC_Os06g18680 intergenic_region ; MODIFIER silent_mutation Average:14.961; most accessible tissue: Callus, score: 83.377 N N N N
vg0610590324 T -> G LOC_Os06g18670.1 upstream_gene_variant ; 385.0bp to feature; MODIFIER silent_mutation Average:14.961; most accessible tissue: Callus, score: 83.377 N N N N
vg0610590324 T -> G LOC_Os06g18670-LOC_Os06g18680 intergenic_region ; MODIFIER silent_mutation Average:14.961; most accessible tissue: Callus, score: 83.377 N N N N
vg0610590324 T -> DEL N N silent_mutation Average:14.961; most accessible tissue: Callus, score: 83.377 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610590324 NA 5.60E-07 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324 1.76E-06 1.16E-20 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324 2.36E-06 1.70E-11 mr1583 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324 NA 2.25E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324 9.21E-07 4.79E-19 mr1218_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324 1.53E-06 6.68E-08 mr1218_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324 2.14E-10 9.78E-38 mr1221_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324 2.63E-08 3.27E-13 mr1221_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324 2.45E-06 2.83E-07 mr1252_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324 NA 2.74E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324 1.63E-08 4.48E-25 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324 8.03E-08 1.73E-09 mr1422_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324 2.50E-07 1.41E-18 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324 9.46E-07 1.22E-10 mr1583_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324 3.54E-07 3.95E-17 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590324 1.14E-06 1.55E-11 mr1850_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251