\
| Variant ID: vg0610590127 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10590127 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.18, others allele: 0.00, population size: 105. )
AAGCATTTGTCTGAAATGGAAAATAAAAAATTTCTTACGTGTCAAAAGTTTCGGAGAGCGCTACGGCTCGGACGTCCGATATCTCACCAAATATCGGACG[T/C]
CCAGCCAAGCAGCGAGCGTATGTGTATGTGTATATTGCTGTACTTCATTCTTCACTCCTCAATCATGAGGAAGCTTCCCATCTAACGTCCTATGTCCCAA
TTGGGACATAGGACGTTAGATGGGAAGCTTCCTCATGATTGAGGAGTGAAGAATGAAGTACAGCAATATACACATACACATACGCTCGCTGCTTGGCTGG[A/G]
CGTCCGATATTTGGTGAGATATCGGACGTCCGAGCCGTAGCGCTCTCCGAAACTTTTGACACGTAAGAAATTTTTTATTTTCCATTTCAGACAAATGCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.70% | 29.30% | 1.46% | 34.45% | NA |
| All Indica | 2759 | 13.30% | 30.00% | 2.10% | 54.58% | NA |
| All Japonica | 1512 | 62.10% | 31.40% | 0.46% | 6.02% | NA |
| Aus | 269 | 83.30% | 16.40% | 0.00% | 0.37% | NA |
| Indica I | 595 | 6.70% | 18.20% | 2.02% | 73.11% | NA |
| Indica II | 465 | 9.90% | 18.70% | 2.15% | 69.25% | NA |
| Indica III | 913 | 18.80% | 44.00% | 1.20% | 35.93% | NA |
| Indica Intermediate | 786 | 13.70% | 29.50% | 3.18% | 53.56% | NA |
| Temperate Japonica | 767 | 52.90% | 43.20% | 0.26% | 3.65% | NA |
| Tropical Japonica | 504 | 68.80% | 19.60% | 0.40% | 11.11% | NA |
| Japonica Intermediate | 241 | 77.20% | 18.70% | 1.24% | 2.90% | NA |
| VI/Aromatic | 96 | 91.70% | 6.20% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 27.80% | 36.70% | 4.44% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610590127 | T -> C | LOC_Os06g18670.1 | upstream_gene_variant ; 188.0bp to feature; MODIFIER | silent_mutation | Average:71.321; most accessible tissue: Zhenshan97 flower, score: 87.106 | N | N | N | N |
| vg0610590127 | T -> C | LOC_Os06g18670-LOC_Os06g18680 | intergenic_region ; MODIFIER | silent_mutation | Average:71.321; most accessible tissue: Zhenshan97 flower, score: 87.106 | N | N | N | N |
| vg0610590127 | T -> DEL | N | N | silent_mutation | Average:71.321; most accessible tissue: Zhenshan97 flower, score: 87.106 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610590127 | 6.56E-06 | NA | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | 3.19E-06 | NA | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | NA | 3.55E-08 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | NA | 1.60E-07 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | 3.51E-10 | NA | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | 2.15E-08 | 1.27E-14 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | NA | 6.57E-07 | mr1218 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | NA | 6.21E-10 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | 9.39E-07 | NA | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | NA | 7.31E-10 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | 8.79E-08 | NA | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | 2.72E-07 | 2.97E-13 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | 4.23E-08 | NA | mr1090_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | NA | 2.18E-08 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | 1.61E-12 | NA | mr1211_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | 1.37E-08 | 6.87E-16 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | 4.88E-06 | 8.80E-12 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | NA | 1.20E-06 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | 6.00E-06 | NA | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | NA | 5.52E-06 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | 5.17E-09 | NA | mr1583_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | 2.81E-08 | 4.51E-13 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | 3.43E-07 | NA | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610590127 | NA | 1.41E-09 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |