\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610590127:

Variant ID: vg0610590127 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10590127
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.18, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCATTTGTCTGAAATGGAAAATAAAAAATTTCTTACGTGTCAAAAGTTTCGGAGAGCGCTACGGCTCGGACGTCCGATATCTCACCAAATATCGGACG[T/C]
CCAGCCAAGCAGCGAGCGTATGTGTATGTGTATATTGCTGTACTTCATTCTTCACTCCTCAATCATGAGGAAGCTTCCCATCTAACGTCCTATGTCCCAA

Reverse complement sequence

TTGGGACATAGGACGTTAGATGGGAAGCTTCCTCATGATTGAGGAGTGAAGAATGAAGTACAGCAATATACACATACACATACGCTCGCTGCTTGGCTGG[A/G]
CGTCCGATATTTGGTGAGATATCGGACGTCCGAGCCGTAGCGCTCTCCGAAACTTTTGACACGTAAGAAATTTTTTATTTTCCATTTCAGACAAATGCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.70% 29.30% 1.46% 34.45% NA
All Indica  2759 13.30% 30.00% 2.10% 54.58% NA
All Japonica  1512 62.10% 31.40% 0.46% 6.02% NA
Aus  269 83.30% 16.40% 0.00% 0.37% NA
Indica I  595 6.70% 18.20% 2.02% 73.11% NA
Indica II  465 9.90% 18.70% 2.15% 69.25% NA
Indica III  913 18.80% 44.00% 1.20% 35.93% NA
Indica Intermediate  786 13.70% 29.50% 3.18% 53.56% NA
Temperate Japonica  767 52.90% 43.20% 0.26% 3.65% NA
Tropical Japonica  504 68.80% 19.60% 0.40% 11.11% NA
Japonica Intermediate  241 77.20% 18.70% 1.24% 2.90% NA
VI/Aromatic  96 91.70% 6.20% 0.00% 2.08% NA
Intermediate  90 27.80% 36.70% 4.44% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610590127 T -> C LOC_Os06g18670.1 upstream_gene_variant ; 188.0bp to feature; MODIFIER silent_mutation Average:71.321; most accessible tissue: Zhenshan97 flower, score: 87.106 N N N N
vg0610590127 T -> C LOC_Os06g18670-LOC_Os06g18680 intergenic_region ; MODIFIER silent_mutation Average:71.321; most accessible tissue: Zhenshan97 flower, score: 87.106 N N N N
vg0610590127 T -> DEL N N silent_mutation Average:71.321; most accessible tissue: Zhenshan97 flower, score: 87.106 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610590127 6.56E-06 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 3.19E-06 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 NA 3.55E-08 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 NA 1.60E-07 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 3.51E-10 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 2.15E-08 1.27E-14 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 NA 6.57E-07 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 NA 6.21E-10 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 9.39E-07 NA mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 NA 7.31E-10 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 8.79E-08 NA mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 2.72E-07 2.97E-13 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 4.23E-08 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 NA 2.18E-08 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 1.61E-12 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 1.37E-08 6.87E-16 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 4.88E-06 8.80E-12 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 NA 1.20E-06 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 6.00E-06 NA mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 NA 5.52E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 5.17E-09 NA mr1583_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 2.81E-08 4.51E-13 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 3.43E-07 NA mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610590127 NA 1.41E-09 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251