\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610564653:

Variant ID: vg0610564653 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10564653
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGCTTGAAAGAGCGAAGTGGTGCCAGCAGACCTGTGCTTTCACGGATGGAATAAGTTCATCATCTTTAGTCCCTTAACTTGTCAACGAGCCCGATTTTC[A/G,T]
TCCTTCAACTGAAAAACCAGATATAACATGTCCCTCAACGGTTAGAATAAGTGCAGATGAGGTCCCTTGACGGTTTGGACGGCGGTTTTAACTGACGTGG

Reverse complement sequence

CCACGTCAGTTAAAACCGCCGTCCAAACCGTCAAGGGACCTCATCTGCACTTATTCTAACCGTTGAGGGACATGTTATATCTGGTTTTTCAGTTGAAGGA[T/C,A]
GAAAATCGGGCTCGTTGACAAGTTAAGGGACTAAAGATGATGAACTTATTCCATCCGTGAAAGCACAGGTCTGCTGGCACCACTTCGCTCTTTCAAGCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.00% 15.00% 0.02% 0.00% T: 2.01%
All Indica  2759 92.00% 4.60% 0.04% 0.00% T: 3.44%
All Japonica  1512 65.70% 34.30% 0.00% 0.00% NA
Aus  269 84.40% 15.60% 0.00% 0.00% NA
Indica I  595 89.20% 10.80% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 91.00% 1.20% 0.00% 0.00% T: 7.78%
Indica Intermediate  786 91.30% 5.50% 0.13% 0.00% T: 3.05%
Temperate Japonica  767 51.20% 48.80% 0.00% 0.00% NA
Tropical Japonica  504 79.00% 21.00% 0.00% 0.00% NA
Japonica Intermediate  241 84.20% 15.80% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610564653 A -> G LOC_Os06g18150.1 upstream_gene_variant ; 794.0bp to feature; MODIFIER silent_mutation Average:96.795; most accessible tissue: Minghui63 young leaf, score: 99.132 N N N N
vg0610564653 A -> G LOC_Os06g18160.1 upstream_gene_variant ; 601.0bp to feature; MODIFIER silent_mutation Average:96.795; most accessible tissue: Minghui63 young leaf, score: 99.132 N N N N
vg0610564653 A -> G LOC_Os06g18150.2 upstream_gene_variant ; 794.0bp to feature; MODIFIER silent_mutation Average:96.795; most accessible tissue: Minghui63 young leaf, score: 99.132 N N N N
vg0610564653 A -> G LOC_Os06g18150-LOC_Os06g18160 intergenic_region ; MODIFIER silent_mutation Average:96.795; most accessible tissue: Minghui63 young leaf, score: 99.132 N N N N
vg0610564653 A -> T LOC_Os06g18150.1 upstream_gene_variant ; 794.0bp to feature; MODIFIER silent_mutation Average:96.795; most accessible tissue: Minghui63 young leaf, score: 99.132 N N N N
vg0610564653 A -> T LOC_Os06g18160.1 upstream_gene_variant ; 601.0bp to feature; MODIFIER silent_mutation Average:96.795; most accessible tissue: Minghui63 young leaf, score: 99.132 N N N N
vg0610564653 A -> T LOC_Os06g18150.2 upstream_gene_variant ; 794.0bp to feature; MODIFIER silent_mutation Average:96.795; most accessible tissue: Minghui63 young leaf, score: 99.132 N N N N
vg0610564653 A -> T LOC_Os06g18150-LOC_Os06g18160 intergenic_region ; MODIFIER silent_mutation Average:96.795; most accessible tissue: Minghui63 young leaf, score: 99.132 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0610564653 A G 0.05 0.06 0.04 0.05 0.05 0.05
vg0610564653 A T 0.01 0.0 0.01 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610564653 1.20E-06 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653 NA 7.86E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653 NA 7.68E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653 5.48E-08 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653 3.59E-06 8.77E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653 NA 5.69E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653 NA 7.97E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653 3.09E-10 NA mr1211 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653 5.50E-07 7.17E-10 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653 NA 5.48E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653 NA 4.97E-08 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653 NA 1.44E-07 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653 3.27E-06 NA mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653 6.98E-07 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653 NA 6.73E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653 7.58E-10 NA mr1211_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653 8.62E-06 1.89E-09 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653 2.36E-06 2.36E-06 mr1474_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251