Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610564653:

Variant ID: vg0610564653 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10564653
Reference Allele: A	Alternative Allele: G,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAGCTTGAAAGAGCGAAGTGGTGCCAGCAGACCTGTGCTTTCACGGATGGAATAAGTTCATCATCTTTAGTCCCTTAACTTGTCAACGAGCCCGATTTTC[A/G,T]
TCCTTCAACTGAAAAACCAGATATAACATGTCCCTCAACGGTTAGAATAAGTGCAGATGAGGTCCCTTGACGGTTTGGACGGCGGTTTTAACTGACGTGG

Reverse complement sequence

CCACGTCAGTTAAAACCGCCGTCCAAACCGTCAAGGGACCTCATCTGCACTTATTCTAACCGTTGAGGGACATGTTATATCTGGTTTTTCAGTTGAAGGA[T/C,A]
GAAAATCGGGCTCGTTGACAAGTTAAGGGACTAAAGATGATGAACTTATTCCATCCGTGAAAGCACAGGTCTGCTGGCACCACTTCGCTCTTTCAAGCTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.00%	15.00%	0.02%	0.00%	T: 2.01%
All Indica	2759	92.00%	4.60%	0.04%	0.00%	T: 3.44%
All Japonica	1512	65.70%	34.30%	0.00%	0.00%	NA
Aus	269	84.40%	15.60%	0.00%	0.00%	NA
Indica I	595	89.20%	10.80%	0.00%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	91.00%	1.20%	0.00%	0.00%	T: 7.78%
Indica Intermediate	786	91.30%	5.50%	0.13%	0.00%	T: 3.05%
Temperate Japonica	767	51.20%	48.80%	0.00%	0.00%	NA
Tropical Japonica	504	79.00%	21.00%	0.00%	0.00%	NA
Japonica Intermediate	241	84.20%	15.80%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610564653	A -> G	LOC_Os06g18150.1	upstream_gene_variant ; 794.0bp to feature; MODIFIER	silent_mutation	Average:96.795; most accessible tissue: Minghui63 young leaf, score: 99.132	N	N	N	N
vg0610564653	A -> G	LOC_Os06g18160.1	upstream_gene_variant ; 601.0bp to feature; MODIFIER	silent_mutation	Average:96.795; most accessible tissue: Minghui63 young leaf, score: 99.132	N	N	N	N
vg0610564653	A -> G	LOC_Os06g18150.2	upstream_gene_variant ; 794.0bp to feature; MODIFIER	silent_mutation	Average:96.795; most accessible tissue: Minghui63 young leaf, score: 99.132	N	N	N	N
vg0610564653	A -> G	LOC_Os06g18150-LOC_Os06g18160	intergenic_region ; MODIFIER	silent_mutation	Average:96.795; most accessible tissue: Minghui63 young leaf, score: 99.132	N	N	N	N
vg0610564653	A -> T	LOC_Os06g18150.1	upstream_gene_variant ; 794.0bp to feature; MODIFIER	silent_mutation	Average:96.795; most accessible tissue: Minghui63 young leaf, score: 99.132	N	N	N	N
vg0610564653	A -> T	LOC_Os06g18160.1	upstream_gene_variant ; 601.0bp to feature; MODIFIER	silent_mutation	Average:96.795; most accessible tissue: Minghui63 young leaf, score: 99.132	N	N	N	N
vg0610564653	A -> T	LOC_Os06g18150.2	upstream_gene_variant ; 794.0bp to feature; MODIFIER	silent_mutation	Average:96.795; most accessible tissue: Minghui63 young leaf, score: 99.132	N	N	N	N
vg0610564653	A -> T	LOC_Os06g18150-LOC_Os06g18160	intergenic_region ; MODIFIER	silent_mutation	Average:96.795; most accessible tissue: Minghui63 young leaf, score: 99.132	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0610564653	A	G	0.05	0.06	0.04	0.05	0.05	0.05
vg0610564653	A	T	0.01	0.0	0.01	-0.01	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610564653	1.20E-06	NA	mr1068	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653	NA	7.86E-06	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653	NA	7.68E-06	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653	5.48E-08	NA	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653	3.59E-06	8.77E-07	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653	NA	5.69E-06	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653	NA	7.97E-07	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653	3.09E-10	NA	mr1211	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653	5.50E-07	7.17E-10	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653	NA	5.48E-06	mr1225	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653	NA	4.97E-08	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653	NA	1.44E-07	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653	3.27E-06	NA	mr1078_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653	6.98E-07	NA	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653	NA	6.73E-07	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653	7.58E-10	NA	mr1211_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653	8.62E-06	1.89E-09	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610564653	2.36E-06	2.36E-06	mr1474_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251