\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610555589:

Variant ID: vg0610555589 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10555589
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


CAGTCTATTGTCTTTTCTCTTTATTGCCATTGGGATTTTAAAAATCGAACATAATTATCGTTCGGGTCCATTTTTTACTTTCTAAAAGTCCCGCCAAACC[G/A]
TCAGTGGCTTTTCCATTATACTTCTTTATGGCTCACCCGCTGCTTCCCTTCTTGATTGTCATTGTGGTTTTAAAATCGAACATGATTGTCATTGGGTTTT

Reverse complement sequence

AAAACCCAATGACAATCATGTTCGATTTTAAAACCACAATGACAATCAAGAAGGGAAGCAGCGGGTGAGCCATAAAGAAGTATAATGGAAAAGCCACTGA[C/T]
GGTTTGGCGGGACTTTTAGAAAGTAAAAAATGGACCCGAACGATAATTATGTTCGATTTTTAAAATCCCAATGGCAATAAAGAGAAAAGACAATAGACTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 37.50% 0.11% 0.68% NA
All Indica  2759 83.40% 16.30% 0.14% 0.22% NA
All Japonica  1512 36.00% 62.40% 0.07% 1.46% NA
Aus  269 1.10% 97.80% 0.00% 1.12% NA
Indica I  595 81.30% 18.50% 0.00% 0.17% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 79.70% 19.70% 0.33% 0.22% NA
Indica Intermediate  786 81.20% 18.30% 0.13% 0.38% NA
Temperate Japonica  767 55.90% 43.20% 0.00% 0.91% NA
Tropical Japonica  504 10.70% 87.30% 0.00% 1.98% NA
Japonica Intermediate  241 25.70% 71.80% 0.41% 2.07% NA
VI/Aromatic  96 11.50% 87.50% 0.00% 1.04% NA
Intermediate  90 63.30% 36.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610555589 G -> A LOC_Os06g18130.1 upstream_gene_variant ; 3147.0bp to feature; MODIFIER silent_mutation Average:41.42; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N
vg0610555589 G -> A LOC_Os06g18120.1 downstream_gene_variant ; 4690.0bp to feature; MODIFIER silent_mutation Average:41.42; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N
vg0610555589 G -> A LOC_Os06g18140.1 downstream_gene_variant ; 398.0bp to feature; MODIFIER silent_mutation Average:41.42; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N
vg0610555589 G -> A LOC_Os06g18150.2 downstream_gene_variant ; 4175.0bp to feature; MODIFIER silent_mutation Average:41.42; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N
vg0610555589 G -> A LOC_Os06g18140-LOC_Os06g18150 intergenic_region ; MODIFIER silent_mutation Average:41.42; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N
vg0610555589 G -> DEL N N silent_mutation Average:41.42; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610555589 2.40E-08 2.18E-15 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 NA 6.39E-11 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 1.55E-07 1.40E-14 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 6.29E-06 1.86E-09 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 7.88E-18 1.45E-27 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 1.46E-09 2.27E-14 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 6.33E-09 6.26E-16 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 7.28E-07 1.06E-10 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 1.31E-08 5.86E-13 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 3.80E-08 8.64E-16 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 NA 1.38E-10 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 1.48E-06 2.53E-10 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 3.26E-09 3.57E-15 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 8.45E-08 5.85E-11 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 1.78E-08 3.98E-12 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 NA 3.04E-09 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 8.76E-06 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 1.19E-08 1.68E-10 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 NA 1.05E-08 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 8.98E-07 1.00E-08 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 1.66E-06 1.97E-12 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 8.39E-07 1.26E-10 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 NA 4.72E-10 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 5.25E-10 2.59E-19 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 1.28E-06 3.58E-14 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 2.71E-06 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 2.15E-12 7.55E-20 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 6.55E-07 NA mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 3.95E-12 6.11E-19 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 3.12E-16 9.38E-33 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 1.93E-12 7.65E-20 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 2.72E-08 3.23E-18 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 1.02E-07 3.75E-14 mr1094_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 2.25E-08 8.49E-17 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 2.02E-09 1.75E-19 mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 5.28E-07 1.48E-14 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 7.49E-06 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 1.16E-10 5.06E-16 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 2.04E-09 1.37E-18 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 7.75E-09 5.83E-14 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 9.38E-09 1.61E-14 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 6.32E-08 5.21E-13 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 5.42E-10 7.48E-14 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 NA 3.70E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 1.69E-07 5.73E-11 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 3.94E-10 2.24E-20 mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 2.68E-12 5.04E-21 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610555589 NA 2.21E-15 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251