\
| Variant ID: vg0610552218 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10552218 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 250. )
GGGCAAATCTCCACAGAAACAACTTCACCTTATTAGCCACTTTGCAATCCCAGATCTTTTTCCAGTTGAAATTCACCCCTGTGCAGTCTCCCCCACCAGA[T/C]
GAGGATGCTTCTTTGCCACTTCTAGCATCTTTGTTCTGTATCGCCACTTTGTAGGCCGATTTAACTGAAAAAACCCCTTTTTGGTCATAGTGCCAGGCAG
CTGCCTGGCACTATGACCAAAAAGGGGTTTTTTCAGTTAAATCGGCCTACAAAGTGGCGATACAGAACAAAGATGCTAGAAGTGGCAAAGAAGCATCCTC[A/G]
TCTGGTGGGGGAGACTGCACAGGGGTGAATTTCAACTGGAAAAAGATCTGGGATTGCAAAGTGGCTAATAAGGTGAAGTTGTTTCTGTGGAGATTTGCCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.30% | 9.00% | 0.21% | 15.49% | NA |
| All Indica | 2759 | 77.30% | 0.40% | 0.33% | 21.93% | NA |
| All Japonica | 1512 | 66.10% | 27.10% | 0.07% | 6.75% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.00% | 0.74% | NA |
| Indica I | 595 | 98.30% | 0.80% | 0.17% | 0.67% | NA |
| Indica II | 465 | 91.00% | 0.00% | 0.00% | 9.03% | NA |
| Indica III | 913 | 61.10% | 0.00% | 0.33% | 38.55% | NA |
| Indica Intermediate | 786 | 72.30% | 0.80% | 0.64% | 26.34% | NA |
| Temperate Japonica | 767 | 46.00% | 48.80% | 0.13% | 5.08% | NA |
| Tropical Japonica | 504 | 90.70% | 0.00% | 0.00% | 9.33% | NA |
| Japonica Intermediate | 241 | 78.80% | 14.50% | 0.00% | 6.64% | NA |
| VI/Aromatic | 96 | 89.60% | 0.00% | 0.00% | 10.42% | NA |
| Intermediate | 90 | 77.80% | 7.80% | 0.00% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610552218 | T -> C | LOC_Os06g18130.1 | synonymous_variant ; p.Ser75Ser; LOW | synonymous_codon | Average:72.675; most accessible tissue: Zhenshan97 flower, score: 86.194 | N | N | N | N |
| vg0610552218 | T -> DEL | LOC_Os06g18130.1 | N | frameshift_variant | Average:72.675; most accessible tissue: Zhenshan97 flower, score: 86.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610552218 | 8.72E-10 | NA | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610552218 | 4.22E-08 | 1.33E-11 | mr1087 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610552218 | NA | 4.84E-07 | mr1096 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610552218 | NA | 1.75E-12 | mr1844 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610552218 | NA | 4.55E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610552218 | NA | 1.08E-12 | mr1879 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610552218 | 6.09E-14 | NA | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610552218 | 3.59E-12 | 1.16E-20 | mr1087_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610552218 | NA | 1.06E-07 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610552218 | NA | 5.51E-06 | mr1094_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610552218 | NA | 3.05E-06 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610552218 | 6.30E-06 | 6.30E-06 | mr1474_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610552218 | NA | 1.16E-11 | mr1844_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610552218 | NA | 4.12E-06 | mr1844_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |