\
| Variant ID: vg0610545862 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10545862 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.04, others allele: 0.00, population size: 55. )
GAATTAGCTATGAGTAAATTGTATGGTGACTGGGATAGTAGCTTTGACAAGCTATATGGTTGGAAGGTAGAGATCGAGAAGAGGTCCCCAGGAAGTATAG[T/C]
CGCCATTAGCTATATGACATTCAAGGACAAGAAGAGATTCACAAGGCTATTTGTGGTACTACACCCTTGCATTCAAGGTTTTTTAGGAGGTTGTAGGCCA
TGGCCTACAACCTCCTAAAAAACCTTGAATGCAAGGGTGTAGTACCACAAATAGCCTTGTGAATCTCTTCTTGTCCTTGAATGTCATATAGCTAATGGCG[A/G]
CTATACTTCCTGGGGACCTCTTCTCGATCTCTACCTTCCAACCATATAGCTTGTCAAAGCTACTATCCCAGTCACCATACAATTTACTCATAGCTAATTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.60% | 13.10% | 0.34% | 42.95% | NA |
| All Indica | 2759 | 57.10% | 15.50% | 0.18% | 27.22% | NA |
| All Japonica | 1512 | 29.00% | 8.30% | 0.20% | 62.50% | NA |
| Aus | 269 | 1.50% | 16.40% | 2.23% | 79.93% | NA |
| Indica I | 595 | 82.00% | 10.80% | 0.17% | 7.06% | NA |
| Indica II | 465 | 72.90% | 17.20% | 0.22% | 9.68% | NA |
| Indica III | 913 | 38.30% | 17.60% | 0.11% | 43.92% | NA |
| Indica Intermediate | 786 | 50.80% | 15.50% | 0.25% | 33.46% | NA |
| Temperate Japonica | 767 | 50.80% | 1.00% | 0.13% | 47.98% | NA |
| Tropical Japonica | 504 | 1.20% | 21.80% | 0.00% | 76.98% | NA |
| Japonica Intermediate | 241 | 17.80% | 2.90% | 0.83% | 78.42% | NA |
| VI/Aromatic | 96 | 5.20% | 3.10% | 1.04% | 90.62% | NA |
| Intermediate | 90 | 42.20% | 21.10% | 1.11% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610545862 | T -> C | LOC_Os06g18110.1 | missense_variant ; p.Val342Ala; MODERATE | nonsynonymous_codon ; V342A | Average:30.928; most accessible tissue: Minghui63 panicle, score: 42.799 | unknown | unknown | DELETERIOUS | 0.00 |
| vg0610545862 | T -> DEL | LOC_Os06g18110.1 | N | frameshift_variant | Average:30.928; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610545862 | 3.88E-24 | NA | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 8.93E-12 | 2.89E-12 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 2.46E-13 | 2.46E-13 | mr1068 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 1.01E-10 | NA | mr1078 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 2.95E-07 | 3.60E-08 | mr1078 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 1.29E-07 | NA | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 6.73E-06 | 1.96E-07 | mr1087 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 2.19E-37 | NA | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 2.57E-18 | 3.40E-24 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 2.99E-13 | 8.62E-16 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | NA | 8.52E-06 | mr1091 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 6.59E-09 | NA | mr1094 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 8.27E-09 | 1.69E-10 | mr1094 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 1.55E-10 | NA | mr1096 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 8.58E-06 | NA | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 1.76E-09 | 9.88E-12 | mr1096 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 7.14E-06 | 7.13E-06 | mr1110 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 2.60E-17 | NA | mr1111 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 1.93E-10 | 5.25E-09 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 3.84E-09 | 3.53E-09 | mr1111 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 2.56E-12 | NA | mr1121 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 1.51E-07 | 5.38E-09 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 9.21E-11 | 4.10E-14 | mr1121 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | NA | 6.26E-06 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 1.03E-16 | NA | mr1144 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 3.33E-11 | 1.18E-08 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 4.39E-08 | 4.39E-08 | mr1144 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 5.58E-08 | NA | mr1200 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 7.32E-06 | 6.66E-07 | mr1200 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 3.35E-43 | 2.95E-50 | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 6.38E-25 | 1.84E-33 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 1.67E-14 | 1.93E-16 | mr1211 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | NA | 1.23E-06 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | NA | 1.74E-07 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 2.30E-06 | 2.30E-06 | mr1877 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 1.53E-06 | 1.53E-06 | mr1065_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 8.86E-28 | NA | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 4.18E-13 | 2.63E-11 | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 2.95E-14 | 9.84E-19 | mr1068_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 3.35E-13 | NA | mr1078_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 6.39E-10 | 1.34E-12 | mr1078_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 6.51E-11 | NA | mr1087_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 9.67E-08 | 6.18E-11 | mr1087_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 2.00E-45 | NA | mr1090_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 1.55E-22 | 1.16E-28 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 2.63E-18 | 1.91E-25 | mr1090_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | NA | 1.49E-07 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 1.25E-14 | NA | mr1094_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 7.49E-08 | NA | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 9.20E-12 | 1.23E-14 | mr1094_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 4.08E-15 | NA | mr1096_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 8.76E-08 | 2.50E-06 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 1.99E-10 | 4.05E-14 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 1.60E-07 | 1.60E-07 | mr1108_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 1.07E-07 | 2.40E-09 | mr1110_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 4.16E-18 | NA | mr1111_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 2.27E-10 | 1.01E-08 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 2.06E-10 | 2.06E-10 | mr1111_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 1.48E-08 | 2.75E-10 | mr1112_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 2.26E-17 | NA | mr1121_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 2.05E-10 | 1.76E-12 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 4.66E-10 | 1.44E-13 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 1.08E-16 | NA | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 5.44E-10 | 3.44E-08 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 3.12E-08 | 3.12E-09 | mr1144_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 1.82E-12 | NA | mr1200_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 1.29E-06 | NA | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 8.22E-07 | 1.83E-09 | mr1200_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 8.60E-49 | NA | mr1211_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 7.11E-28 | 1.37E-38 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 1.23E-14 | 3.11E-19 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 2.81E-07 | 2.81E-07 | mr1234_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 5.88E-07 | NA | mr1244_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 3.73E-06 | NA | mr1244_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | 5.91E-06 | NA | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610545862 | NA | 6.73E-09 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |