\
| Variant ID: vg0610540066 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10540066 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 50. )
AGTATTCAATTCATCCTGGCAGTACTAAAATGTACCAGGATCTCAAGGAAAAATTCTGGTGGGCCAGCATGAGAAGAGAAATAGCCGAATTCGTCGCACT[C/T]
TGCGATGTTTGTCAGCGAGTCAAAGCAAAACATCAAAGGCCCACAGGATTGTTACAACCTCTTCAGATCCCAGAATTGAAATAGGAAGAAATTGGAATGG
CCATTCCAATTTCTTCCTATTTCAATTCTGGGATCTGAAGAGGTTGTAACAATCCTGTGGGCCTTTGATGTTTTGCTTTGACTCGCTGACAAACATCGCA[G/A]
AGTGCGACGAATTCGGCTATTTCTCTTCTCATGCTGGCCCACCAGAATTTTTCCTTGAGATCCTGGTACATTTTAGTACTGCCAGGATGAATTGAATACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.50% | 20.00% | 5.44% | 19.13% | NA |
| All Indica | 2759 | 58.70% | 26.90% | 5.55% | 8.81% | NA |
| All Japonica | 1512 | 50.90% | 8.30% | 4.63% | 36.18% | NA |
| Aus | 269 | 55.80% | 16.40% | 6.69% | 21.19% | NA |
| Indica I | 595 | 82.70% | 14.80% | 1.34% | 1.18% | NA |
| Indica II | 465 | 76.30% | 17.40% | 2.15% | 4.09% | NA |
| Indica III | 913 | 34.50% | 40.60% | 9.64% | 15.22% | NA |
| Indica Intermediate | 786 | 58.30% | 25.80% | 5.98% | 9.92% | NA |
| Temperate Japonica | 767 | 66.80% | 0.90% | 4.43% | 27.90% | NA |
| Tropical Japonica | 504 | 33.50% | 22.00% | 4.56% | 39.88% | NA |
| Japonica Intermediate | 241 | 36.50% | 3.30% | 5.39% | 54.77% | NA |
| VI/Aromatic | 96 | 32.30% | 7.30% | 12.50% | 47.92% | NA |
| Intermediate | 90 | 56.70% | 26.70% | 4.44% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610540066 | C -> T | LOC_Os06g18110.1 | upstream_gene_variant ; 3317.0bp to feature; MODIFIER | silent_mutation | Average:41.43; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| vg0610540066 | C -> T | LOC_Os06g18090.1 | downstream_gene_variant ; 4120.0bp to feature; MODIFIER | silent_mutation | Average:41.43; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| vg0610540066 | C -> T | LOC_Os06g18100.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.43; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| vg0610540066 | C -> DEL | N | N | silent_mutation | Average:41.43; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610540066 | 1.85E-06 | NA | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 6.33E-11 | 6.33E-11 | mr1068 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | NA | 1.56E-06 | mr1078 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | NA | 4.66E-06 | mr1087 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 4.68E-12 | NA | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 8.74E-09 | 2.22E-11 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 5.36E-08 | 1.50E-09 | mr1094 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 6.96E-07 | 1.05E-08 | mr1096 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 7.64E-07 | NA | mr1111 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 1.02E-10 | 1.05E-10 | mr1111 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 9.12E-09 | 5.94E-12 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 1.98E-06 | NA | mr1144 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 2.09E-08 | 2.09E-08 | mr1144 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 8.15E-15 | NA | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 1.02E-06 | 5.66E-10 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 1.50E-09 | 3.35E-11 | mr1211 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | NA | 1.08E-07 | mr1218 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | NA | 6.60E-09 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | NA | 1.14E-08 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 3.16E-06 | NA | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 1.47E-06 | 2.03E-12 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 8.68E-06 | 8.68E-06 | mr1850 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 2.67E-06 | 2.67E-06 | mr1877 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 8.83E-09 | 2.46E-12 | mr1068_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 6.87E-06 | 6.06E-08 | mr1078_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 1.31E-11 | NA | mr1090_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 4.83E-11 | 4.78E-16 | mr1090_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 2.12E-07 | 1.66E-09 | mr1094_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 6.22E-06 | 3.35E-08 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | NA | 1.20E-06 | mr1110_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 2.85E-06 | NA | mr1111_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 5.91E-09 | 5.91E-09 | mr1111_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 3.45E-06 | 9.90E-09 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 5.80E-06 | NA | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 7.75E-07 | 1.01E-07 | mr1144_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 1.36E-15 | NA | mr1211_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | NA | 1.03E-09 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 1.19E-10 | 1.05E-13 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | NA | 5.44E-11 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 1.69E-07 | NA | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 9.12E-07 | 8.58E-12 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | NA | 9.15E-09 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610540066 | 2.44E-06 | 2.44E-06 | mr1877_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |