\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610540066:

Variant ID: vg0610540066 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10540066
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 50. )

Flanking Sequence (100 bp) in Reference Genome:


AGTATTCAATTCATCCTGGCAGTACTAAAATGTACCAGGATCTCAAGGAAAAATTCTGGTGGGCCAGCATGAGAAGAGAAATAGCCGAATTCGTCGCACT[C/T]
TGCGATGTTTGTCAGCGAGTCAAAGCAAAACATCAAAGGCCCACAGGATTGTTACAACCTCTTCAGATCCCAGAATTGAAATAGGAAGAAATTGGAATGG

Reverse complement sequence

CCATTCCAATTTCTTCCTATTTCAATTCTGGGATCTGAAGAGGTTGTAACAATCCTGTGGGCCTTTGATGTTTTGCTTTGACTCGCTGACAAACATCGCA[G/A]
AGTGCGACGAATTCGGCTATTTCTCTTCTCATGCTGGCCCACCAGAATTTTTCCTTGAGATCCTGGTACATTTTAGTACTGCCAGGATGAATTGAATACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 20.00% 5.44% 19.13% NA
All Indica  2759 58.70% 26.90% 5.55% 8.81% NA
All Japonica  1512 50.90% 8.30% 4.63% 36.18% NA
Aus  269 55.80% 16.40% 6.69% 21.19% NA
Indica I  595 82.70% 14.80% 1.34% 1.18% NA
Indica II  465 76.30% 17.40% 2.15% 4.09% NA
Indica III  913 34.50% 40.60% 9.64% 15.22% NA
Indica Intermediate  786 58.30% 25.80% 5.98% 9.92% NA
Temperate Japonica  767 66.80% 0.90% 4.43% 27.90% NA
Tropical Japonica  504 33.50% 22.00% 4.56% 39.88% NA
Japonica Intermediate  241 36.50% 3.30% 5.39% 54.77% NA
VI/Aromatic  96 32.30% 7.30% 12.50% 47.92% NA
Intermediate  90 56.70% 26.70% 4.44% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610540066 C -> T LOC_Os06g18110.1 upstream_gene_variant ; 3317.0bp to feature; MODIFIER silent_mutation Average:41.43; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 N N N N
vg0610540066 C -> T LOC_Os06g18090.1 downstream_gene_variant ; 4120.0bp to feature; MODIFIER silent_mutation Average:41.43; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 N N N N
vg0610540066 C -> T LOC_Os06g18100.1 intron_variant ; MODIFIER silent_mutation Average:41.43; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 N N N N
vg0610540066 C -> DEL N N silent_mutation Average:41.43; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610540066 1.85E-06 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 6.33E-11 6.33E-11 mr1068 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 NA 1.56E-06 mr1078 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 NA 4.66E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 4.68E-12 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 8.74E-09 2.22E-11 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 5.36E-08 1.50E-09 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 6.96E-07 1.05E-08 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 7.64E-07 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 1.02E-10 1.05E-10 mr1111 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 9.12E-09 5.94E-12 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 1.98E-06 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 2.09E-08 2.09E-08 mr1144 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 8.15E-15 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 1.02E-06 5.66E-10 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 1.50E-09 3.35E-11 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 NA 1.08E-07 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 NA 6.60E-09 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 NA 1.14E-08 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 3.16E-06 NA mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 1.47E-06 2.03E-12 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 8.68E-06 8.68E-06 mr1850 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 2.67E-06 2.67E-06 mr1877 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 8.83E-09 2.46E-12 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 6.87E-06 6.06E-08 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 1.31E-11 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 4.83E-11 4.78E-16 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 2.12E-07 1.66E-09 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 6.22E-06 3.35E-08 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 NA 1.20E-06 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 2.85E-06 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 5.91E-09 5.91E-09 mr1111_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 3.45E-06 9.90E-09 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 5.80E-06 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 7.75E-07 1.01E-07 mr1144_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 1.36E-15 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 NA 1.03E-09 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 1.19E-10 1.05E-13 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 NA 5.44E-11 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 1.69E-07 NA mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 9.12E-07 8.58E-12 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 NA 9.15E-09 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610540066 2.44E-06 2.44E-06 mr1877_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251