\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610533048:

Variant ID: vg0610533048 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10533048
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.02, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGTTTCGGGAAAATTTTGGGGTTTGTTCTTTTGATTTGTGGGAAAAATCTTGATCGCTACTTTAATTGGATTTCCCGACTAGTGACAGTTTAGGGTTT[T/C]
AGTAAAATTTTGTTTGGAATTTATTTGGCAGTCAGTCGGGAATTTGTTAAGTGATATGCATTAAGTCGAGTCTAGGTTCGATGGGGTGCAATCCTGATGT

Reverse complement sequence

ACATCAGGATTGCACCCCATCGAACCTAGACTCGACTTAATGCATATCACTTAACAAATTCCCGACTGACTGCCAAATAAATTCCAAACAAAATTTTACT[A/G]
AAACCCTAAACTGTCACTAGTCGGGAAATCCAATTAAAGTAGCGATCAAGATTTTTCCCACAAATCAAAAGAACAAACCCCAAAATTTTCCCGAAACAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.30% 6.00% 5.92% 28.73% NA
All Indica  2759 68.20% 9.70% 4.35% 17.76% NA
All Japonica  1512 50.80% 0.60% 9.19% 39.42% NA
Aus  269 20.10% 0.00% 2.60% 77.32% NA
Indica I  595 94.10% 0.00% 1.34% 4.54% NA
Indica II  465 77.00% 14.20% 1.72% 7.10% NA
Indica III  913 51.30% 13.70% 5.91% 29.13% NA
Indica Intermediate  786 63.00% 9.80% 6.36% 20.87% NA
Temperate Japonica  767 62.10% 0.50% 7.69% 29.73% NA
Tropical Japonica  504 44.40% 0.60% 8.73% 46.23% NA
Japonica Intermediate  241 28.20% 0.80% 14.94% 56.02% NA
VI/Aromatic  96 42.70% 0.00% 9.38% 47.92% NA
Intermediate  90 66.70% 7.80% 5.56% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610533048 T -> C LOC_Os06g18090.1 upstream_gene_variant ; 583.0bp to feature; MODIFIER silent_mutation Average:38.025; most accessible tissue: Callus, score: 57.008 N N N N
vg0610533048 T -> C LOC_Os06g18080.1 downstream_gene_variant ; 3094.0bp to feature; MODIFIER silent_mutation Average:38.025; most accessible tissue: Callus, score: 57.008 N N N N
vg0610533048 T -> C LOC_Os06g18080-LOC_Os06g18090 intergenic_region ; MODIFIER silent_mutation Average:38.025; most accessible tissue: Callus, score: 57.008 N N N N
vg0610533048 T -> DEL N N silent_mutation Average:38.025; most accessible tissue: Callus, score: 57.008 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610533048 8.15E-09 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 1.87E-08 5.88E-10 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 7.49E-09 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 4.88E-10 2.01E-15 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 8.21E-07 NA mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 1.82E-06 2.23E-08 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 NA 1.11E-06 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 1.04E-08 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 6.78E-07 2.00E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 3.32E-09 NA mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 7.58E-08 9.13E-11 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 NA 7.56E-09 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 1.07E-09 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 1.51E-08 6.54E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 6.10E-12 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 1.07E-12 5.25E-17 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 1.06E-11 NA mr1068_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 4.48E-10 2.09E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 2.23E-13 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 3.22E-14 6.04E-18 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 6.99E-10 NA mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 1.93E-07 1.32E-09 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 3.19E-09 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 2.70E-07 8.02E-08 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 2.82E-10 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 5.72E-09 8.30E-08 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 8.13E-13 NA mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 3.09E-10 2.32E-13 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 3.27E-10 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 1.35E-08 2.08E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 4.53E-07 NA mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 2.84E-06 NA mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 5.55E-15 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610533048 8.94E-16 7.02E-21 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251