Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610532521:

Variant ID: vg0610532521 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10532521
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:

TACTGCTTTTAAATTCTTAAATTCCTGCTTTATGCAATTGAACCCTAGCCTCCTTTGGATATATCTTGCATCATACCTCCTCTTCCGGTATGACTTGCTG[A/C]
GTACAGTGGGTAGTACTCAGCCTTGCTCTCTTTCCCCCCACACCAAAGTTGAAGTTCTTCTCAGTTGGAGATGTCTCGAAGAAGTTGGTTTCGTCGCTGC

Reverse complement sequence

GCAGCGACGAAACCAACTTCTTCGAGACATCTCCAACTGAGAAGAACTTCAACTTTGGTGTGGGGGGAAAGAGAGCAAGGCTGAGTACTACCCACTGTAC[T/G]
CAGCAAGTCATACCGGAAGAGGAGGTATGATGCAAGATATATCCAAAGGAGGCTAGGGTTCAATTGCATAAAGCAGGAATTTAAGAATTTAAAAGCAGTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.30%	11.70%	1.52%	38.49%	NA
All Indica	2759	61.50%	14.90%	1.67%	21.89%	NA
All Japonica	1512	31.60%	8.00%	1.12%	59.26%	NA
Aus	269	18.20%	0.70%	1.12%	79.93%	NA
Indica I	595	83.00%	10.60%	0.34%	6.05%	NA
Indica II	465	75.30%	16.30%	0.22%	8.17%	NA
Indica III	913	44.50%	17.20%	2.30%	36.04%	NA
Indica Intermediate	786	57.00%	14.60%	2.80%	25.57%	NA
Temperate Japonica	767	54.00%	0.70%	1.17%	44.20%	NA
Tropical Japonica	504	2.80%	21.60%	0.99%	74.60%	NA
Japonica Intermediate	241	20.70%	2.90%	1.24%	75.10%	NA
VI/Aromatic	96	14.60%	1.00%	6.25%	78.12%	NA
Intermediate	90	46.70%	21.10%	0.00%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610532521	A -> C	LOC_Os06g18090.1	upstream_gene_variant ; 1110.0bp to feature; MODIFIER	silent_mutation	Average:49.82; most accessible tissue: Minghui63 young leaf, score: 72.408	N	N	N	N
vg0610532521	A -> C	LOC_Os06g18080.1	downstream_gene_variant ; 2567.0bp to feature; MODIFIER	silent_mutation	Average:49.82; most accessible tissue: Minghui63 young leaf, score: 72.408	N	N	N	N
vg0610532521	A -> C	LOC_Os06g18080-LOC_Os06g18090	intergenic_region ; MODIFIER	silent_mutation	Average:49.82; most accessible tissue: Minghui63 young leaf, score: 72.408	N	N	N	N
vg0610532521	A -> DEL	N	N	silent_mutation	Average:49.82; most accessible tissue: Minghui63 young leaf, score: 72.408	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610532521	NA	1.62E-08	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521	NA	1.52E-06	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521	NA	4.86E-08	mr1085	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521	NA	1.41E-08	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521	NA	1.13E-07	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521	NA	7.47E-10	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521	NA	1.07E-10	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521	NA	1.23E-11	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521	NA	6.32E-07	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521	NA	3.76E-08	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521	NA	4.50E-09	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521	NA	8.49E-07	mr1949	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521	7.44E-07	NA	mr1082_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521	NA	2.77E-07	mr1088_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521	NA	9.49E-06	mr1224_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521	NA	7.28E-06	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521	NA	2.40E-08	mr1246_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521	NA	1.06E-07	mr1620_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251