\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610532521:

Variant ID: vg0610532521 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10532521
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:


TACTGCTTTTAAATTCTTAAATTCCTGCTTTATGCAATTGAACCCTAGCCTCCTTTGGATATATCTTGCATCATACCTCCTCTTCCGGTATGACTTGCTG[A/C]
GTACAGTGGGTAGTACTCAGCCTTGCTCTCTTTCCCCCCACACCAAAGTTGAAGTTCTTCTCAGTTGGAGATGTCTCGAAGAAGTTGGTTTCGTCGCTGC

Reverse complement sequence

GCAGCGACGAAACCAACTTCTTCGAGACATCTCCAACTGAGAAGAACTTCAACTTTGGTGTGGGGGGAAAGAGAGCAAGGCTGAGTACTACCCACTGTAC[T/G]
CAGCAAGTCATACCGGAAGAGGAGGTATGATGCAAGATATATCCAAAGGAGGCTAGGGTTCAATTGCATAAAGCAGGAATTTAAGAATTTAAAAGCAGTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.30% 11.70% 1.52% 38.49% NA
All Indica  2759 61.50% 14.90% 1.67% 21.89% NA
All Japonica  1512 31.60% 8.00% 1.12% 59.26% NA
Aus  269 18.20% 0.70% 1.12% 79.93% NA
Indica I  595 83.00% 10.60% 0.34% 6.05% NA
Indica II  465 75.30% 16.30% 0.22% 8.17% NA
Indica III  913 44.50% 17.20% 2.30% 36.04% NA
Indica Intermediate  786 57.00% 14.60% 2.80% 25.57% NA
Temperate Japonica  767 54.00% 0.70% 1.17% 44.20% NA
Tropical Japonica  504 2.80% 21.60% 0.99% 74.60% NA
Japonica Intermediate  241 20.70% 2.90% 1.24% 75.10% NA
VI/Aromatic  96 14.60% 1.00% 6.25% 78.12% NA
Intermediate  90 46.70% 21.10% 0.00% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610532521 A -> C LOC_Os06g18090.1 upstream_gene_variant ; 1110.0bp to feature; MODIFIER silent_mutation Average:49.82; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N
vg0610532521 A -> C LOC_Os06g18080.1 downstream_gene_variant ; 2567.0bp to feature; MODIFIER silent_mutation Average:49.82; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N
vg0610532521 A -> C LOC_Os06g18080-LOC_Os06g18090 intergenic_region ; MODIFIER silent_mutation Average:49.82; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N
vg0610532521 A -> DEL N N silent_mutation Average:49.82; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610532521 NA 1.62E-08 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521 NA 1.52E-06 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521 NA 4.86E-08 mr1085 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521 NA 1.41E-08 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521 NA 1.13E-07 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521 NA 7.47E-10 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521 NA 1.07E-10 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521 NA 1.23E-11 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521 NA 6.32E-07 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521 NA 3.76E-08 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521 NA 4.50E-09 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521 NA 8.49E-07 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521 7.44E-07 NA mr1082_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521 NA 2.77E-07 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521 NA 9.49E-06 mr1224_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521 NA 7.28E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521 NA 2.40E-08 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610532521 NA 1.06E-07 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251