\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610531607:

Variant ID: vg0610531607 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10531607
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.03, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGTCATACATTACAATTGATCATATTGTACCCAATTTACAAATGTCCTGCATTTCTATTAAATGTTGCATTGTTTTACAATATCTTGTGGGATAGGTT[T/C]
TAGTACTCAGCCATACTTTGTTTACCTTATGCCATTGATAACTTGGGTATTAAAATGCTTAGATGTTTGTTTAGGGAATGTTTAGCCATGCTTAGTTCAA

Reverse complement sequence

TTGAACTAAGCATGGCTAAACATTCCCTAAACAAACATCTAAGCATTTTAATACCCAAGTTATCAATGGCATAAGGTAAACAAAGTATGGCTGAGTACTA[A/G]
AACCTATCCCACAAGATATTGTAAAACAATGCAACATTTAATAGAAATGCAGGACATTTGTAAATTGGGTACAATATGATCAATTGTAATGTATGACTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.80% 23.70% 0.44% 42.13% NA
All Indica  2759 55.90% 17.00% 0.29% 26.82% NA
All Japonica  1512 1.50% 37.20% 0.60% 60.78% NA
Aus  269 0.40% 19.30% 0.37% 79.93% NA
Indica I  595 81.00% 12.30% 0.00% 6.72% NA
Indica II  465 72.90% 17.60% 0.00% 9.46% NA
Indica III  913 37.30% 18.80% 0.22% 43.59% NA
Indica Intermediate  786 48.20% 18.20% 0.76% 32.82% NA
Temperate Japonica  767 1.60% 52.00% 0.39% 46.02% NA
Tropical Japonica  504 1.00% 23.00% 0.79% 75.20% NA
Japonica Intermediate  241 2.10% 19.50% 0.83% 77.59% NA
VI/Aromatic  96 2.10% 8.30% 1.04% 88.54% NA
Intermediate  90 33.30% 28.90% 2.22% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610531607 T -> C LOC_Os06g18090.1 upstream_gene_variant ; 2024.0bp to feature; MODIFIER silent_mutation Average:44.844; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg0610531607 T -> C LOC_Os06g18080.1 downstream_gene_variant ; 1653.0bp to feature; MODIFIER silent_mutation Average:44.844; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg0610531607 T -> C LOC_Os06g18080-LOC_Os06g18090 intergenic_region ; MODIFIER silent_mutation Average:44.844; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg0610531607 T -> DEL N N silent_mutation Average:44.844; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610531607 1.09E-07 NA mr1090 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607 4.46E-07 1.02E-11 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607 NA 7.21E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607 1.58E-09 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607 3.87E-10 5.62E-16 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607 NA 1.22E-08 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607 NA 5.36E-07 mr1242 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607 NA 1.83E-07 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607 NA 2.34E-10 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607 1.67E-06 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607 NA 1.83E-12 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607 6.10E-08 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607 1.11E-07 2.31E-16 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607 NA 2.23E-11 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607 NA 1.17E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607 NA 3.33E-10 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607 NA 9.53E-09 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251