Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610531607:

Variant ID: vg0610531607 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10531607
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.03, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGTCATACATTACAATTGATCATATTGTACCCAATTTACAAATGTCCTGCATTTCTATTAAATGTTGCATTGTTTTACAATATCTTGTGGGATAGGTT[T/C]
TAGTACTCAGCCATACTTTGTTTACCTTATGCCATTGATAACTTGGGTATTAAAATGCTTAGATGTTTGTTTAGGGAATGTTTAGCCATGCTTAGTTCAA

Reverse complement sequence

TTGAACTAAGCATGGCTAAACATTCCCTAAACAAACATCTAAGCATTTTAATACCCAAGTTATCAATGGCATAAGGTAAACAAAGTATGGCTGAGTACTA[A/G]
AACCTATCCCACAAGATATTGTAAAACAATGCAACATTTAATAGAAATGCAGGACATTTGTAAATTGGGTACAATATGATCAATTGTAATGTATGACTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.80%	23.70%	0.44%	42.13%	NA
All Indica	2759	55.90%	17.00%	0.29%	26.82%	NA
All Japonica	1512	1.50%	37.20%	0.60%	60.78%	NA
Aus	269	0.40%	19.30%	0.37%	79.93%	NA
Indica I	595	81.00%	12.30%	0.00%	6.72%	NA
Indica II	465	72.90%	17.60%	0.00%	9.46%	NA
Indica III	913	37.30%	18.80%	0.22%	43.59%	NA
Indica Intermediate	786	48.20%	18.20%	0.76%	32.82%	NA
Temperate Japonica	767	1.60%	52.00%	0.39%	46.02%	NA
Tropical Japonica	504	1.00%	23.00%	0.79%	75.20%	NA
Japonica Intermediate	241	2.10%	19.50%	0.83%	77.59%	NA
VI/Aromatic	96	2.10%	8.30%	1.04%	88.54%	NA
Intermediate	90	33.30%	28.90%	2.22%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610531607	T -> C	LOC_Os06g18090.1	upstream_gene_variant ; 2024.0bp to feature; MODIFIER	silent_mutation	Average:44.844; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0610531607	T -> C	LOC_Os06g18080.1	downstream_gene_variant ; 1653.0bp to feature; MODIFIER	silent_mutation	Average:44.844; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0610531607	T -> C	LOC_Os06g18080-LOC_Os06g18090	intergenic_region ; MODIFIER	silent_mutation	Average:44.844; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0610531607	T -> DEL	N	N	silent_mutation	Average:44.844; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610531607	1.09E-07	NA	mr1090	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607	4.46E-07	1.02E-11	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607	NA	7.21E-06	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607	1.58E-09	NA	mr1211	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607	3.87E-10	5.62E-16	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607	NA	1.22E-08	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607	NA	5.36E-07	mr1242	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607	NA	1.83E-07	mr1422	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607	NA	2.34E-10	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607	1.67E-06	NA	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607	NA	1.83E-12	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607	6.10E-08	NA	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607	1.11E-07	2.31E-16	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607	NA	2.23E-11	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607	NA	1.17E-07	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607	NA	3.33E-10	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531607	NA	9.53E-09	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251