Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610531602:

Variant ID: vg0610531602 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10531602
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAAGGCAAGTCATACATTACAATTGATCATATTGTACCCAATTTACAAATGTCCTGCATTTCTATTAAATGTTGCATTGTTTTACAATATCTTGTGGGAT[A/G]
GGTTTTAGTACTCAGCCATACTTTGTTTACCTTATGCCATTGATAACTTGGGTATTAAAATGCTTAGATGTTTGTTTAGGGAATGTTTAGCCATGCTTAG

Reverse complement sequence

CTAAGCATGGCTAAACATTCCCTAAACAAACATCTAAGCATTTTAATACCCAAGTTATCAATGGCATAAGGTAAACAAAGTATGGCTGAGTACTAAAACC[T/C]
ATCCCACAAGATATTGTAAAACAATGCAACATTTAATAGAAATGCAGGACATTTGTAAATTGGGTACAATATGATCAATTGTAATGTATGACTTGCCTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.20%	10.10%	0.47%	42.28%	NA
All Indica	2759	71.80%	1.10%	0.54%	26.57%	NA
All Japonica	1512	9.70%	28.70%	0.40%	61.18%	NA
Aus	269	16.70%	1.10%	0.00%	82.16%	NA
Indica I	595	92.10%	1.20%	0.34%	6.39%	NA
Indica II	465	89.70%	0.90%	0.00%	9.46%	NA
Indica III	913	56.10%	0.40%	0.99%	42.50%	NA
Indica Intermediate	786	64.00%	2.00%	0.51%	33.46%	NA
Temperate Japonica	767	2.50%	51.10%	0.52%	45.89%	NA
Tropical Japonica	504	22.80%	0.40%	0.40%	76.39%	NA
Japonica Intermediate	241	5.40%	16.60%	0.00%	78.01%	NA
VI/Aromatic	96	7.30%	1.00%	1.04%	90.62%	NA
Intermediate	90	57.80%	6.70%	0.00%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610531602	A -> G	LOC_Os06g18090.1	upstream_gene_variant ; 2029.0bp to feature; MODIFIER	silent_mutation	Average:44.676; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0610531602	A -> G	LOC_Os06g18080.1	downstream_gene_variant ; 1648.0bp to feature; MODIFIER	silent_mutation	Average:44.676; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0610531602	A -> G	LOC_Os06g18080-LOC_Os06g18090	intergenic_region ; MODIFIER	silent_mutation	Average:44.676; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0610531602	A -> DEL	N	N	silent_mutation	Average:44.676; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610531602	NA	8.18E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531602	4.24E-11	NA	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531602	1.89E-09	3.44E-14	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531602	NA	2.06E-06	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610531602	9.01E-06	9.01E-06	mr1756_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251