\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610495424:

Variant ID: vg0610495424 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10495424
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


ACTGTTTGCCAATTATGGATGGAGATTTACCAATAGACTGGAATAATGTTATTTTGTCTAGTTTGGTTACCTTTTAATTTTGGTTGGTGTGTTTGCTTTC[T/A]
TTTGGTCTGCACTCTTACAGAGTGCTAGTTTGTAATAATTGCCTGTAGCTCTTTTGAGCAAAGGCCGGGATGTTATTTTATTCCATTATCTAAAAAAAGA

Reverse complement sequence

TCTTTTTTTAGATAATGGAATAAAATAACATCCCGGCCTTTGCTCAAAAGAGCTACAGGCAATTATTACAAACTAGCACTCTGTAAGAGTGCAGACCAAA[A/T]
GAAAGCAAACACACCAACCAAAATTAAAAGGTAACCAAACTAGACAAAATAACATTATTCCAGTCTATTGGTAAATCTCCATCCATAATTGGCAAACAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.90% 12.00% 7.96% 26.13% NA
All Indica  2759 66.40% 7.40% 9.82% 16.31% NA
All Japonica  1512 39.60% 15.30% 3.84% 41.27% NA
Aus  269 19.70% 37.20% 13.01% 30.11% NA
Indica I  595 84.20% 2.00% 5.38% 8.40% NA
Indica II  465 73.30% 2.80% 11.40% 12.47% NA
Indica III  913 54.30% 11.10% 13.80% 20.81% NA
Indica Intermediate  786 63.00% 10.10% 7.63% 19.34% NA
Temperate Japonica  767 54.90% 4.00% 1.69% 39.37% NA
Tropical Japonica  504 24.20% 32.90% 6.75% 36.11% NA
Japonica Intermediate  241 23.20% 14.10% 4.56% 58.09% NA
VI/Aromatic  96 10.40% 19.80% 4.17% 65.62% NA
Intermediate  90 58.90% 13.30% 8.89% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610495424 T -> A LOC_Os06g18030.1 upstream_gene_variant ; 2779.0bp to feature; MODIFIER silent_mutation Average:32.418; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg0610495424 T -> A LOC_Os06g18020-LOC_Os06g18030 intergenic_region ; MODIFIER silent_mutation Average:32.418; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg0610495424 T -> DEL N N silent_mutation Average:32.418; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610495424 NA 2.66E-08 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 NA 1.46E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 NA 1.93E-08 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 NA 4.18E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 NA 2.35E-06 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 1.01E-06 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 NA 1.96E-09 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 8.24E-06 NA mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 NA 1.20E-07 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 7.77E-06 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 NA 2.06E-06 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 NA 1.37E-06 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 6.90E-07 NA mr1096_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 NA 7.93E-08 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 5.94E-07 NA mr1111_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 NA 4.39E-10 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 NA 4.29E-07 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 3.30E-06 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 NA 3.43E-08 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 6.55E-08 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 NA 2.58E-06 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495424 NA 9.38E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251