\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610495392:

Variant ID: vg0610495392 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10495392
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGTGTCGTAGGCTTGAAACGATGATTATGCAACTGTTTGCCAATTATGGATGGAGATTTACCAATAGACTGGAATAATGTTATTTTGTCTAGTTTGGTT[A/T]
CCTTTTAATTTTGGTTGGTGTGTTTGCTTTCTTTTGGTCTGCACTCTTACAGAGTGCTAGTTTGTAATAATTGCCTGTAGCTCTTTTGAGCAAAGGCCGG

Reverse complement sequence

CCGGCCTTTGCTCAAAAGAGCTACAGGCAATTATTACAAACTAGCACTCTGTAAGAGTGCAGACCAAAAGAAAGCAAACACACCAACCAAAATTAAAAGG[T/A]
AACCAAACTAGACAAAATAACATTATTCCAGTCTATTGGTAAATCTCCATCCATAATTGGCAAACAGTTGCATAATCATCGTTTCAAGCCTACGACACGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 18.40% 7.02% 17.10% NA
All Indica  2759 72.40% 17.10% 5.91% 4.60% NA
All Japonica  1512 39.70% 17.00% 4.70% 38.56% NA
Aus  269 18.20% 39.00% 28.25% 14.50% NA
Indica I  595 92.80% 1.50% 3.36% 2.35% NA
Indica II  465 90.50% 4.30% 3.44% 1.72% NA
Indica III  913 54.50% 30.30% 9.64% 5.48% NA
Indica Intermediate  786 67.00% 21.00% 4.96% 7.00% NA
Temperate Japonica  767 55.10% 4.20% 2.74% 37.94% NA
Tropical Japonica  504 24.40% 36.30% 6.35% 32.94% NA
Japonica Intermediate  241 22.80% 17.40% 7.47% 52.28% NA
VI/Aromatic  96 10.40% 22.90% 14.58% 52.08% NA
Intermediate  90 63.30% 17.80% 8.89% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610495392 A -> T LOC_Os06g18030.1 upstream_gene_variant ; 2811.0bp to feature; MODIFIER silent_mutation Average:29.225; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0610495392 A -> T LOC_Os06g18020-LOC_Os06g18030 intergenic_region ; MODIFIER silent_mutation Average:29.225; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0610495392 A -> DEL N N silent_mutation Average:29.225; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610495392 NA 7.75E-10 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 7.65E-06 NA mr1078 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 NA 1.16E-09 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 NA 1.99E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 NA 1.15E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 NA 4.29E-08 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 NA 9.96E-07 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 NA 2.42E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 NA 1.07E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 NA 2.35E-06 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 NA 1.34E-10 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 5.33E-08 NA mr1078_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 NA 4.12E-12 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 NA 1.26E-08 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 NA 6.88E-08 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 NA 1.88E-09 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 NA 7.20E-11 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 NA 2.60E-07 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 NA 2.74E-09 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 1.01E-06 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610495392 NA 3.75E-07 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251