\
| Variant ID: vg0610494475 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10494475 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 286. )
CTTTTGAAGAGAAAGTATCTTTACAATAAGTCTATTACCCAAGTTGACAGGAAACAAGGTGACTCCCATTTTTGGTCAGGACTCATGAAAGTCAAAAACA[C/T]
TTTCTTAACTATGGGTTCTTGGATTGTGAATAATGGGGAACAAATAAGATTTTGGGAAGATAAATGGCTAGGAAATATGGCCTTTAGAGAAAAGTATCCA
TGGATACTTTTCTCTAAAGGCCATATTTCCTAGCCATTTATCTTCCCAAAATCTTATTTGTTCCCCATTATTCACAATCCAAGAACCCATAGTTAAGAAA[G/A]
TGTTTTTGACTTTCATGAGTCCTGACCAAAAATGGGAGTCACCTTGTTTCCTGTCAACTTGGGTAATAGACTTATTGTAAAGATACTTTCTCTTCAAAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.10% | 1.80% | 0.87% | 11.24% | NA |
| All Indica | 2759 | 99.30% | 0.10% | 0.22% | 0.33% | NA |
| All Japonica | 1512 | 60.10% | 4.40% | 2.12% | 33.40% | NA |
| Aus | 269 | 93.70% | 1.90% | 0.74% | 3.72% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.00% | 0.50% | NA |
| Indica II | 465 | 99.40% | 0.00% | 0.43% | 0.22% | NA |
| Indica III | 913 | 99.70% | 0.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 0.40% | 0.25% | 0.64% | NA |
| Temperate Japonica | 767 | 67.80% | 0.00% | 1.69% | 30.51% | NA |
| Tropical Japonica | 504 | 54.40% | 12.70% | 2.58% | 30.36% | NA |
| Japonica Intermediate | 241 | 47.70% | 0.80% | 2.49% | 48.96% | NA |
| VI/Aromatic | 96 | 86.50% | 8.30% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 96.70% | 0.00% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610494475 | C -> T | LOC_Os06g18030.1 | upstream_gene_variant ; 3728.0bp to feature; MODIFIER | silent_mutation | Average:29.035; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| vg0610494475 | C -> T | LOC_Os06g18020.1 | downstream_gene_variant ; 4561.0bp to feature; MODIFIER | silent_mutation | Average:29.035; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| vg0610494475 | C -> T | LOC_Os06g18020-LOC_Os06g18030 | intergenic_region ; MODIFIER | silent_mutation | Average:29.035; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| vg0610494475 | C -> DEL | N | N | silent_mutation | Average:29.035; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610494475 | 3.58E-06 | 6.36E-08 | mr1076 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610494475 | NA | 6.51E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610494475 | NA | 2.86E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610494475 | NA | 4.26E-06 | mr1215 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610494475 | 3.05E-06 | 1.51E-08 | mr1227 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610494475 | NA | 6.94E-06 | mr1408 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610494475 | NA | 3.24E-09 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610494475 | NA | 1.67E-07 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610494475 | 5.35E-06 | 8.71E-08 | mr1929_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |