\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610494475:

Variant ID: vg0610494475 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10494475
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTTGAAGAGAAAGTATCTTTACAATAAGTCTATTACCCAAGTTGACAGGAAACAAGGTGACTCCCATTTTTGGTCAGGACTCATGAAAGTCAAAAACA[C/T]
TTTCTTAACTATGGGTTCTTGGATTGTGAATAATGGGGAACAAATAAGATTTTGGGAAGATAAATGGCTAGGAAATATGGCCTTTAGAGAAAAGTATCCA

Reverse complement sequence

TGGATACTTTTCTCTAAAGGCCATATTTCCTAGCCATTTATCTTCCCAAAATCTTATTTGTTCCCCATTATTCACAATCCAAGAACCCATAGTTAAGAAA[G/A]
TGTTTTTGACTTTCATGAGTCCTGACCAAAAATGGGAGTCACCTTGTTTCCTGTCAACTTGGGTAATAGACTTATTGTAAAGATACTTTCTCTTCAAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.10% 1.80% 0.87% 11.24% NA
All Indica  2759 99.30% 0.10% 0.22% 0.33% NA
All Japonica  1512 60.10% 4.40% 2.12% 33.40% NA
Aus  269 93.70% 1.90% 0.74% 3.72% NA
Indica I  595 99.50% 0.00% 0.00% 0.50% NA
Indica II  465 99.40% 0.00% 0.43% 0.22% NA
Indica III  913 99.70% 0.10% 0.22% 0.00% NA
Indica Intermediate  786 98.70% 0.40% 0.25% 0.64% NA
Temperate Japonica  767 67.80% 0.00% 1.69% 30.51% NA
Tropical Japonica  504 54.40% 12.70% 2.58% 30.36% NA
Japonica Intermediate  241 47.70% 0.80% 2.49% 48.96% NA
VI/Aromatic  96 86.50% 8.30% 1.04% 4.17% NA
Intermediate  90 96.70% 0.00% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610494475 C -> T LOC_Os06g18030.1 upstream_gene_variant ; 3728.0bp to feature; MODIFIER silent_mutation Average:29.035; most accessible tissue: Minghui63 root, score: 41.911 N N N N
vg0610494475 C -> T LOC_Os06g18020.1 downstream_gene_variant ; 4561.0bp to feature; MODIFIER silent_mutation Average:29.035; most accessible tissue: Minghui63 root, score: 41.911 N N N N
vg0610494475 C -> T LOC_Os06g18020-LOC_Os06g18030 intergenic_region ; MODIFIER silent_mutation Average:29.035; most accessible tissue: Minghui63 root, score: 41.911 N N N N
vg0610494475 C -> DEL N N silent_mutation Average:29.035; most accessible tissue: Minghui63 root, score: 41.911 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610494475 3.58E-06 6.36E-08 mr1076 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610494475 NA 6.51E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610494475 NA 2.86E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610494475 NA 4.26E-06 mr1215 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610494475 3.05E-06 1.51E-08 mr1227 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610494475 NA 6.94E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610494475 NA 3.24E-09 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610494475 NA 1.67E-07 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610494475 5.35E-06 8.71E-08 mr1929_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251