\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610488848:

Variant ID: vg0610488848 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10488848
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAGCTGTCATTAGCACATGTGAGTTACTGTAGCACTTATGGCTAATCACGGACTAATTAGACTTAAAAGATTCGTCTCGCGATTTCCTCTATAACTGTG[C/T]
AATTAATTTTTTTTTTATCAATATTTAATGCTTCATGTATGTGTCTAAAGATTCGATGTGATGTTTTTGGGAAAAATTTTTGGCAACTAAGCGGGCCCTA

Reverse complement sequence

TAGGGCCCGCTTAGTTGCCAAAAATTTTTCCCAAAAACATCACATCGAATCTTTAGACACATACATGAAGCATTAAATATTGATAAAAAAAAAATTAATT[G/A]
CACAGTTATAGAGGAAATCGCGAGACGAATCTTTTAAGTCTAATTAGTCCGTGATTAGCCATAAGTGCTACAGTAACTCACATGTGCTAATGACAGCTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.30% 3.60% 2.64% 44.48% NA
All Indica  2759 65.40% 2.30% 1.63% 30.66% NA
All Japonica  1512 27.80% 6.70% 4.83% 60.71% NA
Aus  269 17.50% 0.00% 1.49% 81.04% NA
Indica I  595 90.30% 1.50% 0.34% 7.90% NA
Indica II  465 89.20% 0.20% 0.43% 10.11% NA
Indica III  913 42.10% 3.60% 2.41% 51.92% NA
Indica Intermediate  786 59.50% 2.70% 2.42% 35.37% NA
Temperate Japonica  767 33.10% 12.90% 8.60% 45.37% NA
Tropical Japonica  504 23.40% 0.20% 0.20% 76.19% NA
Japonica Intermediate  241 19.90% 0.40% 2.49% 77.18% NA
VI/Aromatic  96 7.30% 1.00% 0.00% 91.67% NA
Intermediate  90 57.80% 3.30% 3.33% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610488848 C -> T LOC_Os06g18020.1 intron_variant ; MODIFIER silent_mutation Average:81.366; most accessible tissue: Minghui63 panicle, score: 95.757 N N N N
vg0610488848 C -> DEL N N silent_mutation Average:81.366; most accessible tissue: Minghui63 panicle, score: 95.757 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0610488848 C T 0.01 0.0 0.0 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610488848 7.42E-09 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610488848 1.15E-06 NA mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610488848 1.11E-06 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610488848 NA 7.06E-07 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610488848 4.44E-06 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610488848 5.28E-15 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610488848 1.96E-06 2.75E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610488848 6.20E-06 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610488848 2.88E-08 NA mr1091_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610488848 NA 1.67E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610488848 7.54E-07 NA mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610488848 5.62E-06 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610488848 7.28E-06 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610488848 NA 7.47E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610488848 NA 3.36E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251